1 Introduction

scRepertoire is designed to take filter contig outputs from the 10x Genomics Cell Ranger pipeline, process that data to assign clonotype based on two TCR or Ig chains and analyze the clonotype dynamics. The latter can be separated into 1) clonotype-only analysis functions, such as unique clonotypes or clonal space quantification, and 2) interaction with mRNA expression data using Seurat or SingleCellExperiment packages.

1.1 Loading Libraries

suppressMessages(library(scRepertoire))

1.2 Loading Data

1.2.1 What data to load into scRepertoire?

scRepertoire primarily functions using the filtered_contig_annotations.csv output generated by 10x Genomics Cell Ranger. This file is typically found in the ./outs/ directory of your VDJ alignment folder.

1.2.2 Demonstrating Manual Data Loading (10x Genomics)

To prepare data for scRepertoire from 10x Genomics outputs, you would:

  • Load the filtered_contig_annotations.csv file for each of your samples.
  • Combine these loaded data frames into a single list in your R environment.
S1 <- read.csv(".../Sample1/outs/filtered_contig_annotations.csv")
S2 <- read.csv(".../Sample2/outs/filtered_contig_annotations.csv")
S3 <- read.csv(".../Sample3/outs/filtered_contig_annotations.csv")
S4 <- read.csv(".../Sample4/outs/filtered_contig_annotations.csv")

contig_list <- list(S1, S2, S3, S4)

1.3 Other alignment workflows

Beyond the default 10x Genomics Cell Ranger pipeline outputs, scRepertoire supports various other single-cell immune receptor sequencing formats through the loadContigs() function.

1.3.1 Supported Formats and Expected File Names

  • 10X: “filtered_contig_annotations.csv”
  • AIRR: “airr_rearrangement.tsv”
  • BD: “Contigs_AIRR.tsv”
  • Dandelion: “all_contig_dandelion.tsv”
  • Immcantation: “_data.tsv” (or similar)
  • JSON: “.json”
  • MiXCR: “clones.tsv”
  • ParseBio: “barcode_report.tsv”
  • TRUST4: “barcode_report.tsv”
  • WAT3R: “barcode_results.csv”

Key Parameter(s) for loadContigs()

  • input: A directory path containing your contig files (the function will recursively search) or a list/data frame of pre-loaded contig data.
  • format: A string specifying the data format (e.g., 10X, TRUST4, WAT3R). If set to “auto”, the function will attempt to automatically detect the format based on file names or data structure.

You can provide loadContigs() with a directory where your sequencing experiments are located, and it will recursively load and process the contig data based on the file names:

# Directory example
contig.output <- c("~/Documents/MyExperiment")
contig.list <- loadContigs(input = contig.output, 
                           format = "TRUST4")

Alternatively, loadContigs() can be given a list of pre-loaded data frames and process the contig data based on the specified format:

# List of data frames example
S1 <- read.csv("~/Documents/MyExperiment/Sample1/outs/barcode_results.csv")
S2 <- read.csv("~/Documents/MyExperiment/Sample2/outs/barcode_results.csv")
S3 <- read.csv("~/Documents/MyExperiment/Sample3/outs/barcode_results.csv")
S4 <- read.csv("~/Documents/MyExperiment/Sample4/outs/barcode_results.csv")

contig.list <- list(S1, S2, S3, S4)
contig.list <- loadContigs(input = contig.list, 
                           format = "WAT3R")

1.4 Multiplexed Experiment

It is now easy to create the contig list from a multiplexed experiment by first generating a single-cell RNA object (either Seurat or Single Cell Experiment), loading the filtered contig file, and then using createHTOContigList(). This function will return a list separated by the group.by variable(s).

1.4.1 Important Considerations for createHTOContigList()

  • This function depends on the match of barcodes between the single-cell object and contigs. If there is a prefix or different suffix added to the barcode, this will result in no contigs being recovered.
  • It is currently recommended to perform this step before integration workflows, as integration commonly alters the barcodes.
  • There is a multi.run variable that can be used on an integrated object. However, it assumes you have modified the barcodes with the Seurat pipeline (automatic addition of _# to the end), and your contig list is in the same order.

To create a contig list separated by HTO (Hash Tag Oligo) IDs from a single-cell object:

contigs <- read.csv(".../outs/filtered_contig_annotations.csv")

contig.list <- createHTOContigList(contigs, 
                                   Seurat.Obj, 
                                   group.by = "HTO_maxID")

1.5 Example Data in scRepertoire

scRepertoire includes a built-in example dataset to demonstrate the functionality of the R package. This dataset consists of T cells derived from four patients with acute respiratory distress with paired peripheral-blood (B) and bronchoalveolar lavage (L), effectively creating 8 distinct runs for T cell receptor (TCR) enrichment. More information on the data set can be found in the corresponding manuscript.

The built-in example data is derived from the 10x Cell Ranger pipeline, so it is ready to go for downstream processing and analysis.

To load and preview the example data built into scRepertoire:

data("contig_list") #the data built into scRepertoire

head(contig_list[[1]])
##              barcode is_cell                   contig_id high_confidence length
## 1 AAACCTGAGTACGACG-1    True AAACCTGAGTACGACG-1_contig_1            True    500
## 2 AAACCTGAGTACGACG-1    True AAACCTGAGTACGACG-1_contig_2            True    478
## 4 AAACCTGCAACACGCC-1    True AAACCTGCAACACGCC-1_contig_1            True    506
## 5 AAACCTGCAACACGCC-1    True AAACCTGCAACACGCC-1_contig_2            True    470
## 6 AAACCTGCAGGCGATA-1    True AAACCTGCAGGCGATA-1_contig_1            True    558
## 7 AAACCTGCAGGCGATA-1    True AAACCTGCAGGCGATA-1_contig_2            True    505
##   chain       v_gene d_gene  j_gene c_gene full_length productive
## 1   TRA       TRAV25   None  TRAJ20   TRAC        True       True
## 2   TRB      TRBV5-1   None TRBJ2-7  TRBC2        True       True
## 4   TRA TRAV38-2/DV8   None  TRAJ52   TRAC        True       True
## 5   TRB     TRBV10-3   None TRBJ2-2  TRBC2        True       True
## 6   TRA     TRAV12-1   None   TRAJ9   TRAC        True       True
## 7   TRB        TRBV9   None TRBJ2-2  TRBC2        True       True
##                 cdr3                                                cdr3_nt
## 1        CGCSNDYKLSF                      TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT
## 2     CASSLTDRTYEQYF             TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 4 CAYRSAQAGGTSYGKLTF TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT
## 5      CAISEQGKGELFF                TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 6     CVVSDNTGGFKTIF             TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
## 7  CASSVRRERANTGELFF    TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##   reads umis raw_clonotype_id         raw_consensus_id
## 1  8344    4     clonotype123 clonotype123_consensus_2
## 2 65390   38     clonotype123 clonotype123_consensus_1
## 4 18372    8     clonotype124 clonotype124_consensus_1
## 5 34054    9     clonotype124 clonotype124_consensus_2
## 6  5018    2       clonotype1   clonotype1_consensus_2
## 7 25110   11       clonotype1   clonotype1_consensus_1

2 Combining Contigs into Clones

The combineTCR() function processes a list of TCR sequencing results, consolidating them to the level of individual cell barcodes. It handles potential issues with repeated barcodes by adding prefixes from samples and ID parameters. The output includes combined reads into clone calls by nucleotide sequence (CTnt), amino acid sequence (CTaa), VDJC gene sequence (CTgene), or a combination of nucleotide and gene sequence (CTstrict).

Key Parameter(s) for combineTCR()

  • input.data: A list of filtered contig annotations (e.g., filtered_contig_annotations.csv from 10x Cell Ranger) or outputs from loadContigs().
  • samples: Labels for your samples (recommended).
  • ID: Additional sample labels (optional).
  • removeNA: If TRUE, removes any cell barcode with an NA value in at least one chain (default is FALSE).
  • removeMulti: If TRUE, removes any cell barcode with more than two immune receptor chains (default is FALSE).
  • filterMulti: If TRUE, isolates the top two expressed chains in cell barcodes with multiple chains (default is FALSE).
  • filterNonproductive: If TRUE, removes non-productive chains if the variable exists in the contig data (default is TRUE).

To combine TCR contigs from contig_list and apply sample prefixes:

combined.TCR <- combineTCR(contig_list, 
                           samples = c("P17B", "P17L", "P18B", "P18L", 
                                            "P19B","P19L", "P20B", "P20L"),
                           removeNA = FALSE, 
                           removeMulti = FALSE, 
                           filterMulti = FALSE)

head(combined.TCR[[1]])
##                    barcode sample                     TCR1           cdr3_aa1
## 1  P17B_AAACCTGAGTACGACG-1   P17B       TRAV25.TRAJ20.TRAC        CGCSNDYKLSF
## 3  P17B_AAACCTGCAACACGCC-1   P17B TRAV38-2/DV8.TRAJ52.TRAC CAYRSAQAGGTSYGKLTF
## 5  P17B_AAACCTGCAGGCGATA-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
## 7  P17B_AAACCTGCATGAGCGA-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
## 9  P17B_AAACGGGAGAGCCCAA-1   P17B        TRAV20.TRAJ8.TRAC      CAVRGEGFQKLVF
## 10 P17B_AAACGGGAGCGTTTAC-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
##                                                  cdr3_nt1
## 1                       TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT
## 3  TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT
## 5              TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
## 7              TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
## 9                 TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT
## 10             TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
##                           TCR2          cdr3_aa2
## 1   TRBV5-1.None.TRBJ2-7.TRBC2    CASSLTDRTYEQYF
## 3  TRBV10-3.None.TRBJ2-2.TRBC2     CAISEQGKGELFF
## 5     TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
## 7     TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
## 9                         <NA>              <NA>
## 10    TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
##                                               cdr3_nt2
## 1           TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3              TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5  TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7  TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                 <NA>
## 10 TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##                                                  CTgene
## 1         TRAV25.TRAJ20.TRAC_TRBV5-1.None.TRBJ2-7.TRBC2
## 3  TRAV38-2/DV8.TRAJ52.TRAC_TRBV10-3.None.TRBJ2-2.TRBC2
## 5          TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
## 7          TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
## 9                                  TRAV20.TRAJ8.TRAC_NA
## 10         TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
##                                                                                              CTnt
## 1                    TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT_TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3  TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT_TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5  TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7  TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                      TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT_NA
## 10 TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##                                CTaa
## 1        CGCSNDYKLSF_CASSLTDRTYEQYF
## 3  CAYRSAQAGGTSYGKLTF_CAISEQGKGELFF
## 5  CVVSDNTGGFKTIF_CASSVRRERANTGELFF
## 7  CVVSDNTGGFKTIF_CASSVRRERANTGELFF
## 9                  CAVRGEGFQKLVF_NA
## 10 CVVSDNTGGFKTIF_CASSVRRERANTGELFF
##                                                                                                                                               CTstrict
## 1                           TRAV25.TRAJ20.TRAC;TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT_TRBV5-1.None.TRBJ2-7.TRBC2;TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3  TRAV38-2/DV8.TRAJ52.TRAC;TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT_TRBV10-3.None.TRBJ2-2.TRBC2;TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5          TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7          TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                                                      TRAV20.TRAJ8.TRAC;TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT_NA;NA
## 10         TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT

combineTCR() is the essential first step for organizing raw TCR sequencing data into a structured format for scRepertoire analyses. It allows for flexible handling of single and paired chains, barcode disambiguation, and initial filtering, producing a list of data frames where each row represents a single cell and its associated TCR clonotypes.

2.1 combineBCR

The combineBCR() function is the primary tool for processing raw B cell receptor contig data into a format ready for analysis. It is analogous to combineTCR() but includes specialized logic for handling the complexities of BCRs, such as somatic hypermutation. The function consolidates contigs into a single data frame per sample, with each row representing a unique cell.

By default (call.related.clones = TRUE), combineBCR() groups B cells into clones based on the similarity of their CDR3 sequences.

2.1.2 Advanced: Grouping by Alignment

For more biological accuracy—specifically when analyzing amino acid sequences—you can use alignment metrics. This allows the clustering to penalize conservative amino acid changes less than radical changes.

Here we use Needleman-Wunsch alignment with the BLOSUM80 substitution matrix:

combined.BCR.aligned <- combineBCR(BCR.contigs, 
                                   samples = "Patient1",
                                   sequence = "aa",        
                                   dist_type = "nw",      
                                   dist_mat = "BLOSUM80",  
                                   threshold = 0.85)

head(combined.BCR.aligned[[1]][, c("barcode", "CTstrict", "IGH", "cdr3_aa1")])
##                       barcode
## 1 Patient1_AAACCTGAGGGCACTA-1
## 2 Patient1_AAACCTGAGTACGTTC-1
## 3 Patient1_AAACCTGAGTCCGGTC-1
## 4 Patient1_AAACCTGCACCAGGTC-1
## 5 Patient1_AAACCTGGTAAATGAC-1
## 6 Patient1_AAACGGGTCACCTCGT-1
##                                                   CTstrict
## 1                                NA_IGLV1-51.CGTWDSSLSAGVF
## 2           IGHV3-64.CAKSYSRDLPRYFGSW_IGKV3-15.CQQYSNWPLTF
## 3                                   NA_IGKV3-20.CQQYGDSLPF
## 4 IGHV1-69-2.CVRDGAGHYGSGIGYYGMDVW_IGLV2-14.CSSYISTSTLEVLF
## 5        IGHV1-46.CSRGRLPMPAAGSGLVSW_IGKV3-15.CQHYHNWPPYTF
## 6                                  NA_IGKV3-11.CQQRSNWPLTF
##                              IGH              cdr3_aa1
## 1                           <NA>                  <NA>
## 2   IGHV3-64.IGHD6-6.IGHJ4.IGHG1      CAKSYSRDLPRYFGSW
## 3                           <NA>                  <NA>
## 4 IGHV1-69-2.IGHD3-10.IGHJ6.IGHM CVRDGAGHYGSGIGYYGMDVW
## 5  IGHV1-46.IGHD6-13.IGHJ5.IGHA2    CSRGRLPMPAAGSGLVSW
## 6                           <NA>                  <NA>

2.1.3 Filtering and Cleaning Data

combineBCR() includes several arguments to filter and clean the contig data during processing. * filterNonproductive = TRUE (Default): Removes any contigs that are not classified as productive, ensuring that only functional receptor chains are included in the analysis. * filterMulti = TRUE (Default): For cells with more than one heavy or light chain detected, this automatically selects the chain with the highest UMI count (read abundance) and discards the others. This helps resolve cellular multiplets or technical artifacts.

Here is an example applying these filters (though they are on by default):

cleaned.BCR <- combineBCR(BCR.contigs,
                          samples = "Patient1",
                          filterNonproductive = TRUE,
                          filterMulti = TRUE)

head(cleaned.BCR[[1]])
##                       barcode   sample                            IGH
## 1 Patient1_AAACCTGAGGGCACTA-1 Patient1                           <NA>
## 2 Patient1_AAACCTGAGTACGTTC-1 Patient1   IGHV3-64.IGHD6-6.IGHJ4.IGHG1
## 3 Patient1_AAACCTGAGTCCGGTC-1 Patient1                           <NA>
## 4 Patient1_AAACCTGCACCAGGTC-1 Patient1 IGHV1-69-2.IGHD3-10.IGHJ6.IGHM
## 5 Patient1_AAACCTGGTAAATGAC-1 Patient1  IGHV1-46.IGHD6-13.IGHJ5.IGHA2
## 6 Patient1_AAACGGGTCACCTCGT-1 Patient1                           <NA>
##                cdr3_aa1
## 1                  <NA>
## 2      CAKSYSRDLPRYFGSW
## 3                  <NA>
## 4 CVRDGAGHYGSGIGYYGMDVW
## 5    CSRGRLPMPAAGSGLVSW
## 6                  <NA>
##                                                          cdr3_nt1
## 1                                                            <NA>
## 2                TGTGCGAAATCGTATAGCAGAGACCTGCCGCGGTACTTTGGCTCCTGG
## 3                                                            <NA>
## 4 TGTGTGAGAGATGGGGCGGGTCACTATGGTTCGGGGATAGGCTACTACGGTATGGACGTCTGG
## 5          TGTTCGAGGGGTCGTCTCCCGATGCCAGCAGCTGGCAGTGGTTTGGTCTCCTGG
## 6                                                            <NA>
##                   IGLC       cdr3_aa2
## 1 IGLV1-51.IGLJ3.IGLC2  CGTWDSSLSAGVF
## 2  IGKV3-15.IGKJ4.IGKC    CQQYSNWPLTF
## 3  IGKV3-20.IGKJ4.IGKC     CQQYGDSLPF
## 4 IGLV2-14.IGLJ2.IGLC2 CSSYISTSTLEVLF
## 5  IGKV3-15.IGKJ2.IGKC   CQHYHNWPPYTF
## 6  IGKV3-11.IGKJ1.IGKC    CQQRSNWPLTF
##                                     cdr3_nt2
## 1    TGCGGAACATGGGATAGCAGCCTGAGTGCTGGCGTGTTC
## 2          TGTCAGCAGTATAGTAACTGGCCGCTCACTTTC
## 3             TGTCAACAGTATGGTGACTCTCTCCCTTTC
## 4 TGCAGTTCATATATAAGTACCAGCACTCTCGAGGTCCTATTC
## 5       TGTCAGCACTATCATAACTGGCCTCCGTACACTTTT
## 6          TGTCAGCAGCGTAGCAACTGGCCTCTGACGTTC
##                                                CTgene
## 1                             NA_IGLV1-51.IGLJ3.IGLC2
## 2    IGHV3-64.IGHD6-6.IGHJ4.IGHG1_IGKV3-15.IGKJ4.IGKC
## 3                              NA_IGKV3-20.IGKJ4.IGKC
## 4 IGHV1-69-2.IGHD3-10.IGHJ6.IGHM_IGLV2-14.IGLJ2.IGLC2
## 5   IGHV1-46.IGHD6-13.IGHJ5.IGHA2_IGKV3-15.IGKJ2.IGKC
## 6                              NA_IGKV3-11.IGKJ1.IGKC
##                                                                                                         CTnt
## 1                                                                 NA_TGCGGAACATGGGATAGCAGCCTGAGTGCTGGCGTGTTC
## 2                         TGTGCGAAATCGTATAGCAGAGACCTGCCGCGGTACTTTGGCTCCTGG_TGTCAGCAGTATAGTAACTGGCCGCTCACTTTC
## 3                                                                          NA_TGTCAACAGTATGGTGACTCTCTCCCTTTC
## 4 TGTGTGAGAGATGGGGCGGGTCACTATGGTTCGGGGATAGGCTACTACGGTATGGACGTCTGG_TGCAGTTCATATATAAGTACCAGCACTCTCGAGGTCCTATTC
## 5                TGTTCGAGGGGTCGTCTCCCGATGCCAGCAGCTGGCAGTGGTTTGGTCTCCTGG_TGTCAGCACTATCATAACTGGCCTCCGTACACTTTT
## 6                                                                       NA_TGTCAGCAGCGTAGCAACTGGCCTCTGACGTTC
##                                   CTaa
## 1                     NA_CGTWDSSLSAGVF
## 2         CAKSYSRDLPRYFGSW_CQQYSNWPLTF
## 3                        NA_CQQYGDSLPF
## 4 CVRDGAGHYGSGIGYYGMDVW_CSSYISTSTLEVLF
## 5      CSRGRLPMPAAGSGLVSW_CQHYHNWPPYTF
## 6                       NA_CQQRSNWPLTF
##                                                                                                                         CTstrict
## 1                                                                            NA_IGLV1-51.TGCGGAACATGGGATAGCAGCCTGAGTGCTGGCGTGTTC
## 2                           IGHV3-64.TGTGCGAAATCGTATAGCAGAGACCTGCCGCGGTACTTTGGCTCCTGG_IGKV3-15.TGTCAGCAGTATAGTAACTGGCCGCTCACTTTC
## 3                                                                                     NA_IGKV3-20.TGTCAACAGTATGGTGACTCTCTCCCTTTC
## 4 IGHV1-69-2.TGTGTGAGAGATGGGGCGGGTCACTATGGTTCGGGGATAGGCTACTACGGTATGGACGTCTGG_IGLV2-14.TGCAGTTCATATATAAGTACCAGCACTCTCGAGGTCCTATTC
## 5                  IGHV1-46.TGTTCGAGGGGTCGTCTCCCGATGCCAGCAGCTGGCAGTGGTTTGGTCTCCTGG_IGKV3-15.TGTCAGCACTATCATAACTGGCCTCCGTACACTTTT
## 6                                                                                  NA_IGKV3-11.TGTCAGCAGCGTAGCAACTGGCCTCTGACGTTC

combineBCR() is designed for processing B cell repertoire data, going beyond simple contig aggregation to incorporate advanced clustering based on CDR3 sequence similarity. This enables the identification of clonally related B cells, crucial for studying B cell development, affinity maturation, and humoral immune responses. Its filtering options further ensure the quality and interpretability of the processed data.


3 Additional Processing

3.1 addVariable: Adding Variables for Plotting

What if there are more variables to add than just sample and ID? We can add them by using the addVariable() function. For each element, the function will add a column (labeled by variable.name) with the variable. The length of the variables parameter needs to match the length of the combined object.

Key Parameter(s) for addVariable()

  • variable.name: A character string that defines the new variable to add (e.g., “Type”, “Treatment”).
  • variables: A character vector defining the desired column value for each list element. Its length must match the number of elements in the input.data list.

As an example, here we add the Type in which the samples were processed and sequenced to the combined.TCR object:

combined.TCR <- addVariable(combined.TCR, 
                            variable.name = "Type", 
                            variables = rep(c("B", "L"), 4))

head(combined.TCR[[1]])
##                    barcode sample                     TCR1           cdr3_aa1
## 1  P17B_AAACCTGAGTACGACG-1   P17B       TRAV25.TRAJ20.TRAC        CGCSNDYKLSF
## 3  P17B_AAACCTGCAACACGCC-1   P17B TRAV38-2/DV8.TRAJ52.TRAC CAYRSAQAGGTSYGKLTF
## 5  P17B_AAACCTGCAGGCGATA-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
## 7  P17B_AAACCTGCATGAGCGA-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
## 9  P17B_AAACGGGAGAGCCCAA-1   P17B        TRAV20.TRAJ8.TRAC      CAVRGEGFQKLVF
## 10 P17B_AAACGGGAGCGTTTAC-1   P17B      TRAV12-1.TRAJ9.TRAC     CVVSDNTGGFKTIF
##                                                  cdr3_nt1
## 1                       TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT
## 3  TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT
## 5              TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
## 7              TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
## 9                 TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT
## 10             TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT
##                           TCR2          cdr3_aa2
## 1   TRBV5-1.None.TRBJ2-7.TRBC2    CASSLTDRTYEQYF
## 3  TRBV10-3.None.TRBJ2-2.TRBC2     CAISEQGKGELFF
## 5     TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
## 7     TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
## 9                         <NA>              <NA>
## 10    TRBV9.None.TRBJ2-2.TRBC2 CASSVRRERANTGELFF
##                                               cdr3_nt2
## 1           TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3              TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5  TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7  TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                 <NA>
## 10 TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##                                                  CTgene
## 1         TRAV25.TRAJ20.TRAC_TRBV5-1.None.TRBJ2-7.TRBC2
## 3  TRAV38-2/DV8.TRAJ52.TRAC_TRBV10-3.None.TRBJ2-2.TRBC2
## 5          TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
## 7          TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
## 9                                  TRAV20.TRAJ8.TRAC_NA
## 10         TRAV12-1.TRAJ9.TRAC_TRBV9.None.TRBJ2-2.TRBC2
##                                                                                              CTnt
## 1                    TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT_TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3  TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT_TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5  TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7  TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                      TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT_NA
## 10 TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##                                CTaa
## 1        CGCSNDYKLSF_CASSLTDRTYEQYF
## 3  CAYRSAQAGGTSYGKLTF_CAISEQGKGELFF
## 5  CVVSDNTGGFKTIF_CASSVRRERANTGELFF
## 7  CVVSDNTGGFKTIF_CASSVRRERANTGELFF
## 9                  CAVRGEGFQKLVF_NA
## 10 CVVSDNTGGFKTIF_CASSVRRERANTGELFF
##                                                                                                                                               CTstrict
## 1                           TRAV25.TRAJ20.TRAC;TGTGGGTGTTCTAACGACTACAAGCTCAGCTTT_TRBV5-1.None.TRBJ2-7.TRBC2;TGCGCCAGCAGCTTGACCGACAGGACCTACGAGCAGTACTTC
## 3  TRAV38-2/DV8.TRAJ52.TRAC;TGTGCTTATAGGAGCGCGCAGGCTGGTGGTACTAGCTATGGAAAGCTGACATTT_TRBV10-3.None.TRBJ2-2.TRBC2;TGTGCCATCAGTGAACAGGGGAAAGGGGAGCTGTTTTTT
## 5          TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 7          TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
## 9                                                                                      TRAV20.TRAJ8.TRAC;TGTGCTGTGCGAGGAGAAGGCTTTCAGAAACTTGTATTT_NA;NA
## 10         TRAV12-1.TRAJ9.TRAC;TGTGTGGTCTCCGATAATACTGGAGGCTTCAAAACTATCTTT_TRBV9.None.TRBJ2-2.TRBC2;TGTGCCAGCAGCGTAAGGAGGGAAAGGGCGAACACCGGGGAGCTGTTTTTT
##    Type
## 1     B
## 3     B
## 5     B
## 7     B
## 9     B
## 10    B

3.2 subsetClones: Filter Out Clonal Information

Likewise, we can remove specific list elements after combineTCR() or combineBCR() using the subsetClones() function. In order to subset, we need to identify the column header we would like to use for subsetting (name) and the specific values to include (variables).

Key Parameter(s) for subsetClones()

  • name: The column header/name in the metadata of input.data to use for subsetting (e.g., “sample”, “Type”).
  • variables: A character vector of the specific values within the chosen name column to retain in the subsetted data.

Below, we isolate just the two sequencing results from “P18L” and “P18B” samples:

subset1 <- subsetClones(combined.TCR, 
                        name = "sample", 
                        variables = c("P18L", "P18B"))

head(subset1[[1]][,1:4])
##                    barcode sample                 TCR1         cdr3_aa1
## 1  P18B_AAACCTGAGGCTCAGA-1   P18B TRAV26-1.TRAJ37.TRAC  CIVRGGSSNTGKLIF
## 3  P18B_AAACCTGCATGACATC-1   P18B    TRAV3.TRAJ20.TRAC    CAVQRSNDYKLSF
## 5  P18B_AAACCTGGTATGCTTG-1   P18B TRAV26-1.TRAJ53.TRAC   CIGSSGGSNYKLTF
## 8  P18B_AAACGGGCAGATGGGT-1   P18B                 <NA>             <NA>
## 9  P18B_AAACGGGTCTTACCGC-1   P18B    TRAV20.TRAJ9.TRAC CAVQAKRYTGGFKTIF
## 12 P18B_AAAGATGAGTTACGGG-1   P18B   TRAV8-3.TRAJ8.TRAC   CAVGGDTGFQKLVF

Alternatively, we can also just select the list elements after combineTCR() or combineBCR().

subset2 <- combined.TCR[c(3,4)]
head(subset2[[1]][,1:4])
##                    barcode sample                 TCR1         cdr3_aa1
## 1  P18B_AAACCTGAGGCTCAGA-1   P18B TRAV26-1.TRAJ37.TRAC  CIVRGGSSNTGKLIF
## 3  P18B_AAACCTGCATGACATC-1   P18B    TRAV3.TRAJ20.TRAC    CAVQRSNDYKLSF
## 5  P18B_AAACCTGGTATGCTTG-1   P18B TRAV26-1.TRAJ53.TRAC   CIGSSGGSNYKLTF
## 8  P18B_AAACGGGCAGATGGGT-1   P18B                 <NA>             <NA>
## 9  P18B_AAACGGGTCTTACCGC-1   P18B    TRAV20.TRAJ9.TRAC CAVQAKRYTGGFKTIF
## 12 P18B_AAAGATGAGTTACGGG-1   P18B   TRAV8-3.TRAJ8.TRAC   CAVGGDTGFQKLVF

3.3 exportClones: Save Clonal Data

After assigning the clone by barcode, we can export the clonal information using exportClones() to save for later use or to integrate with other bioinformatics pipelines. This function supports various output formats tailored for different analytical needs.

Key Parameter(s) for exportClones() * format: The desired output format for the clonal data. * airr: Exports data in an Adaptive Immune Receptor Repertoire (AIRR) Community-compliant format, with each row representing a single receptor chain. * immunarch: Exports a list containing a data frame and metadata formatted for use with the immunarch package. * paired: Exports a data frame with paired chain information (amino acid, nucleotide, genes) per barcode. This is the default. * TCRMatch: Exports a data frame specifically for the TCRMatch algorithm, containing TRB chain amino acid sequence and clonal frequency. * tcrpheno: Exports a data frame compatible with the tcrpheno pipeline, with TRA and TRB chains in separate columns. * write.file: If TRUE (default), saves the output to a CSV file. If FALSE, returns the data frame or list to the R environment. * dir: The directory where the output file will be saved. Defaults to the current working directory. * file.name: The name of the CSV file to be saved.

To export the combined clonotypes as a paired data frame and save it to a specified directory:

exportClones(combined, 
             write.file = TRUE,
             dir = "~/Documents/MyExperiment/Sample1/"
             file.name = "clones.csv")

To return an immunarch-formatted data frame directly to your R environment without saving a file:

immunarch <- exportClones(combined.TCR, 
                          format = "immunarch", 
                          write.file = FALSE)
head(immunarch[[1]][[1]])
##   Clones   Proportion                                             CDR3.nt
## 1      1 0.0003565062    NA;TGCGCCAGCAGTCGGGGACTAGCGGGATACAATGAGCAGTTCTTC
## 2      1 0.0003565062       NA;TGTGCCATCAGCGCGGACCCCCGCTACAATGAGCAGTTCTTC
## 3      1 0.0003565062 NA;TGTGCCAGCAGCTTGAGGGACAGCTATCGGTACTATGGCTACACCTTC
## 4      2 0.0007130125          NA;TGTGCCAGCAGCCGGCAGGGCGCAGATACGCAGTATTTT
## 5      1 0.0003565062       NA;TGTGCCAGCAGTCCCTTTACAGGGTTCTATGGCTACACCTTC
## 6      1 0.0003565062          NA;TGTGCCAGCTCATCCGGGATCAATCAGCCCCAGCATTTT
##               CDR3.aa      V.name  D.name     J.name   C.name
## 1  NA;CASSRGLAGYNEQFF NA;TRBV10-2 NA;None NA;TRBJ2-1 NA;TRBC2
## 2   NA;CAISADPRYNEQFF NA;TRBV10-3 NA;None NA;TRBJ2-1 NA;TRBC2
## 3 NA;CASSLRDSYRYYGYTF NA;TRBV11-3 NA;None NA;TRBJ1-2 NA;TRBC1
## 4    NA;CASSRQGADTQYF NA;TRBV11-3 NA;None NA;TRBJ2-3 NA;TRBC2
## 5   NA;CASSPFTGFYGYTF NA;TRBV12-4 NA;None NA;TRBJ1-2 NA;TRBC1
## 6    NA;CASSSGINQPQHF   NA;TRBV18 NA;None NA;TRBJ1-5 NA;TRBC1
##                                           Barcode
## 1                         P17B_AGCGGTCCAAAGGAAG-1
## 2                         P17B_GGCTCGAGTCGCGGTT-1
## 3                         P17B_CGCGTTTTCGGCTACG-1
## 4 P17B_CACCAGGGTTCCTCCA-1;P17B_TCTATTGCAGGTGCCT-1
## 5                         P17B_GCTGGGTGTACGAAAT-1
## 6                         P17B_AGGGTGACATTGGTAC-1

3.4 clonalBin: Bin Clones by Frequency or Proportion

The clonalBin() function adds a clonal grouping variable (cloneSize) to the output of combineTCR(), combineBCR(), or combineExpression(). This function calculates the clonal frequency and proportion, then bins clones into categories based on customizable thresholds. This is useful for categorizing clones prior to downstream analysis or visualization, without needing to attach the data to a single-cell object.

Key Parameter(s) for clonalBin()

  • clone.call: Defines the clonal sequence grouping (gene, nt, aa, or strict).
  • chain: The TCR/BCR chain to use (both, TRA, TRB, TRG, TRD, IGH, IGL).
  • group.by: A column header in the metadata to group the analysis by (e.g., “sample”, “Type”).
  • proportion: Whether to use proportion (TRUE) or total frequency (FALSE) for binning.
  • clone.size: The bins for grouping based on proportion or frequency.

3.4.1 Basic Usage with Proportion

By default, clonalBin() uses proportion-based binning with the following default bins: c(Rare = 1e-4, Small = 0.001, Medium = 0.01, Large = 0.1, Hyperexpanded = 1).

combined.TCR <- clonalBin(combined.TCR, clone.call = "strict")

# Check the cloneSize column
head(combined.TCR[[1]][, c("barcode", "CTstrict", "clonalProportion", "clonalFrequency", "cloneSize")])
##                   barcode
## 1 P17B_AGCGGTCCAAAGGAAG-1
## 2 P17B_GGCTCGAGTCGCGGTT-1
## 3 P17B_CGCGTTTTCGGCTACG-1
## 4 P17B_CACCAGGGTTCCTCCA-1
## 5 P17B_TCTATTGCAGGTGCCT-1
## 6 P17B_GCTGGGTGTACGAAAT-1
##                                                                             CTstrict
## 1    NA;NA_TRBV10-2.None.TRBJ2-1.TRBC2;TGCGCCAGCAGTCGGGGACTAGCGGGATACAATGAGCAGTTCTTC
## 2       NA;NA_TRBV10-3.None.TRBJ2-1.TRBC2;TGTGCCATCAGCGCGGACCCCCGCTACAATGAGCAGTTCTTC
## 3 NA;NA_TRBV11-3.None.TRBJ1-2.TRBC1;TGTGCCAGCAGCTTGAGGGACAGCTATCGGTACTATGGCTACACCTTC
## 4          NA;NA_TRBV11-3.None.TRBJ2-3.TRBC2;TGTGCCAGCAGCCGGCAGGGCGCAGATACGCAGTATTTT
## 5          NA;NA_TRBV11-3.None.TRBJ2-3.TRBC2;TGTGCCAGCAGCCGGCAGGGCGCAGATACGCAGTATTTT
## 6       NA;NA_TRBV12-4.None.TRBJ1-2.TRBC1;TGTGCCAGCAGTCCCTTTACAGGGTTCTATGGCTACACCTTC
##   clonalProportion clonalFrequency                  cloneSize
## 1     0.0003565062               1 Small (1e-04 < X <= 0.001)
## 2     0.0003565062               1 Small (1e-04 < X <= 0.001)
## 3     0.0003565062               1 Small (1e-04 < X <= 0.001)
## 4     0.0007130125               2 Small (1e-04 < X <= 0.001)
## 5     0.0007130125               2 Small (1e-04 < X <= 0.001)
## 6     0.0003565062               1 Small (1e-04 < X <= 0.001)
# View the distribution of clone sizes
table(combined.TCR[[1]]$cloneSize)
## 
## Hyperexpanded (0.1 < X <= 1)      Large (0.01 < X <= 0.1) 
##                          952                          784 
##   Medium (0.001 < X <= 0.01)   Small (1e-04 < X <= 0.001) 
##                          340                          729 
##        Rare (0 < X <= 1e-04)             None ( < X <= 0) 
##                            0                            0

3.4.2 Using Frequency-Based Binning

When using frequency-based binning (proportion = FALSE), the clone.size values must be integers. If the maximum frequency exceeds the upper bin limit, it will be automatically adjusted.

combined.TCR.freq <- combineTCR(contig_list,
                                samples = c("P17B", "P17L", "P18B", "P18L",
                                            "P19B","P19L", "P20B", "P20L"))

combined.TCR.freq <- clonalBin(combined.TCR.freq,
                               clone.call = "strict",
                               proportion = FALSE,
                               clone.size = c(Rare = 1, Small = 5, Medium = 20,
                                              Large = 100, Hyperexpanded = 500))

# Check the frequency-based binning
head(combined.TCR.freq[[1]][, c("barcode", "clonalFrequency", "cloneSize")])
##                   barcode clonalFrequency          cloneSize
## 1 P17B_AGCGGTCCAAAGGAAG-1               1  Rare (0 < X <= 1)
## 2 P17B_GGCTCGAGTCGCGGTT-1               1  Rare (0 < X <= 1)
## 3 P17B_CGCGTTTTCGGCTACG-1               1  Rare (0 < X <= 1)
## 4 P17B_CACCAGGGTTCCTCCA-1               2 Small (1 < X <= 5)
## 5 P17B_TCTATTGCAGGTGCCT-1               2 Small (1 < X <= 5)
## 6 P17B_GCTGGGTGTACGAAAT-1               1  Rare (0 < X <= 1)

3.4.3 Grouping by a Variable

You can calculate clonal frequency and proportion across samples grouped by a variable (e.g., “Type” or “sample”). This is particularly useful when you want consistent binning across experimental conditions.

combined.TCR.grouped <- combineTCR(contig_list,
                                   samples = c("P17B", "P17L", "P18B", "P18L",
                                               "P19B","P19L", "P20B", "P20L"))

combined.TCR.grouped <- addVariable(combined.TCR.grouped,
                                    variable.name = "Type",
                                    variables = rep(c("B", "L"), 4))

combined.TCR.grouped <- clonalBin(combined.TCR.grouped,
                                  clone.call = "strict",
                                  group.by = "Type")

# Check grouped binning
head(combined.TCR.grouped[[1]][, c("barcode", "Type", "clonalProportion", "cloneSize")])
##                   barcode Type clonalProportion                  cloneSize
## 1 P20B_TACTCGCAGAGGTTGC-1    B     4.983554e-05      Rare (0 < X <= 1e-04)
## 2 P18L_CGTGTCTGTGTATGGG-1    L     1.404692e-04 Small (1e-04 < X <= 0.001)
## 3 P18L_AGTGTCAGTAGCGCAA-1    L     1.404692e-04 Small (1e-04 < X <= 0.001)
## 4 P18L_TTTACTGCAAGTTCTG-1    L     1.404692e-04 Small (1e-04 < X <= 0.001)
## 5 P19L_GTGTGCGCAAAGGAAG-1    L     1.404692e-04 Small (1e-04 < X <= 0.001)
## 6 P20L_CCCTCCTAGTAGCGGT-1    L     1.404692e-04 Small (1e-04 < X <= 0.001)

3.5 annotateInvariant

The annotateInvariant() function enables the identification of mucosal-associated invariant T (MAIT) cells and invariant natural killer T (iNKT) cells in single-cell sequencing datasets. These specialized T-cell subsets are defined by their characteristic TCR usage, making them distinguishable within single-cell immune profiling data. The function extracts TCR chain information from the provided single-cell dataset and evaluates it against known invariant TCR criteria for either MAIT or iNKT cells. Each cell is assigned a score indicating the presence (1) or absence (0) of the specified invariant T-cell population.

Key Parameter(s) for annotateInavriant()

  • type: Character string specifying the type of invariant T cell to annotate (MAIT or iNKT).
  • species: Character string specifying the species (mouse or human).
combined <- annotateInvariant(combined, 
                              type = "MAIT", 
                              species = "human")

combined <- annotateInvariant(combined, 
                              type = "iNKT", 
                              species = "human")

4 Basic Clonal Visualizations

4.1 cloneCall: How to call clones.

  • gene - use the VDJC genes comprising the TCR/Ig
  • nt - use the nucleotide sequence of the CDR3 region
  • aa - use the amino acid sequence of the CDR3 region
  • strict - use the VDJC genes comprising the TCR + the nucleotide sequence of the CDR3 region. This is the proper definition of clonotype. For combineBCR() strict refers to the edit distance clusters + Vgene of the Ig.

It is important to note that the clonotype is called using essentially the combination of genes or nt/aa CDR3 sequences for both loci. As of this implementation of scRepertoire, clonotype calling is not incorporating small variations within the CDR3 sequences. As such the gene approach will be the most sensitive, while the use of nt or aa is moderately so, and the most specific for clonotypes being strict. Additionally, the clonotype call is trying to incorporate both loci, i.e., both TCRA and TCRB chains and if a single cell barcode has multiple sequences identified (i.e., 2 TCRA chains expressed in one cell). Using the 10x approach, there is a subset of barcodes that only return one of the immune receptor chains. The unreturned chain is assigned an NA value.

4.2 clonalQuant: Quantifying Unique Clones

The clonalQuant() function is used to explore the clones by returning the total or relative numbers of unique clones.

Key Parameter(s) for clonalQuant()

  • scale: If TRUE, converts the output to the relative percentage of unique clones scaled by the total repertoire size; if FALSE (default), reports the total number of unique clones.

To visualize the relative percent of unique clones across all chains ("both") using the strict clone definition:

clonalQuant(combined.TCR, 
            cloneCall="strict", 
            chain = "both", 
            scale = TRUE)

Another option is to define the visualization by data classes using the group.by parameter. Here, we’ll use the "Type" variable, which was previously added to the combined.TCR list.

clonalQuant(combined.TCR, 
            cloneCall="gene", 
            group.by = "Type", 
            scale = TRUE)

4.3 clonalAbundance: Distribution of Clones by Size

clonalAbundance() allows for the examination of the relative distribution of clones by abundance. It produces a line graph showing the total number of clones at specific frequencies within a sample or group.

Key Parameter(s) for clonalAbundance()

  • scale: If TRUE, converts the graphs into density plots to show relative distributions; if FALSE (default), displays raw counts.

To visualize the raw clonal abundance using the gene clone definition:

clonalAbundance(combined.TCR, 
                cloneCall = "gene", 
                scale = FALSE)

clonalAbundance() output can also be converted into a density plot, which may allow for better comparisons between different repertoire sizes, by setting scale = TRUE.

clonalAbundance(combined.TCR, 
                cloneCall = "gene", 
                scale = TRUE)

4.4 clonalLength: Distribution of Sequence Lengths

clonalLength() allows you to look at the length distribution of the CDR3 sequences. Importantly, unlike the other basic visualizations, the cloneCall can only be nt (nucleotide) or aa (amino acid). Due to the method of calling clones as outlined previously (e.g., using NA for unreturned chain sequences or multiple chains within a single barcode), the length distribution may reveal a multimodal curve.

To visualize the amino acid length distribution for both chains (“both”):

clonalLength(combined.TCR, 
             cloneCall="aa", 
             chain = "both") 

To visualize the amino acid length distribution for the TRA chain, scaled as a density plot:

clonalLength(combined.TCR, 
             cloneCall="aa", 
             chain = "TRA", 
             scale = TRUE) 

4.5 clonalCompare: Clonal Dynamics Between Categorical Variables

clonalCompare() allows you to look at clones between samples and changes in dynamics. It is useful for tracking how the proportions of top clones change between conditions.

Key Parameters for clonalCompare()

  • samples: A character vector to isolate specific samples by their list element name.
  • clones: A character vector of specific clonal sequences to visualize. If used, top.clones will be ignored. *top.clones: The top n number of clones to graph, calculated based on the frequency within individual samples.
  • highlight.clones: A character vector of specific clonal sequences to color; all other clones will be greyed out.
  • relabel.clones: If TRUE, simplifies the legend by labeling isolated clones numerically (e.g., “Clone: 1”).
  • graph: The type of plot to generate; alluvial (default) or area.
  • proportion: If TRUE (default), the y-axis represents proportional abundance; if FALSE, it represents raw clone counts.

To compare the top 10 clones between samples “P17B” and “P17L” using amino acid sequences as an alluvial plot:

clonalCompare(combined.TCR, 
                  top.clones = 10, 
                  samples = c("P17B", "P17L"), 
                  cloneCall="aa", 
                  graph = "alluvial")

We can also choose to highlight specific clones, such as in the case of “CVVSDNTGGFKTIF_CASSVRRERANTGELFF” and “NA_CASSVRRERANTGELFF” using the highlight.clones parameter. In addition, we can simplify the plot to label the clones as “Clone: 1”, “Clone: 2”, etc., by setting relabel.clones = TRUE.

clonalCompare(combined.TCR, 
              top.clones = 10,
              highlight.clones = c("CVVSDNTGGFKTIF_CASSVRRERANTGELFF", "NA_CASSVRRERANTGELFF"),
              relabel.clones = TRUE,
              samples = c("P17B", "P17L"), 
              cloneCall="aa", 
              graph = "alluvial")

Alternatively, if we only want to show specific clones, we can use the clones parameter.

clonalCompare(combined.TCR, 
              clones = c("CVVSDNTGGFKTIF_CASSVRRERANTGELFF", "NA_CASSVRRERANTGELFF"),
              relabel.clones = TRUE,
              samples = c("P17B", "P17L"), 
              cloneCall="aa", 
              graph = "alluvial")

4.6 clonalScatter: Scatterplot of Two Variables

clonalScatter() organizes two repertoires, quantifies their relative clone sizes, and produces a scatter plot comparing the two samples. Clones are categorized by counts into singlets or expanded, either exclusively present or shared between the selected samples.

Key Parameter(s) for clonalScatter()

  • x.axis, y.axis: Names of the list elements or meta data variable to place on the x-axis and y-axis.
  • dot.size: Specifies how dot size is determined; total (default) displays the total number of clones between the x- and y-axis, or a specific list element name for size calculation.
  • graph: The type of graph to display; proportion for the relative proportion of clones (default) or count for the total count of clones by sample.

To compare samples “P18B” and “P18L” based on gene clone calls, with dot size representing the total number of clones, and plotting clone proportions:

clonalScatter(combined.TCR, 
              cloneCall ="gene", 
              x.axis = "P18B", 
              y.axis = "P18L",
              dot.size = "total",
              graph = "proportion")


5 Visualizing Clonal Dynamics

5.1 clonalHomeostasis: Examining Clonal Space

By examining the clonal space, we effectively look at the relative space occupied by clones at specific proportions. Another way to think about this would be to consider the total immune receptor sequencing run as a measuring cup. In this cup, we will fill liquids of different viscosity—or different numbers of clonal proportions. Clonal space homeostasis asks what percentage of the cup is filled by clones in distinct proportions (or liquids of different viscosity, to extend the analogy). The proportional cut points are set under the cloneSize variable in the function and can be adjusted.

Default cloneSize Bins

  • Rare: 0 to 0.0001
  • Small: 0.0001 to 0.001
  • Medium: 0.001 to 0.01
  • Large: 0.01 to 0.1
  • Hyperexpanded: 0.1 to 1

To visualize clonal homeostasis using gene clone calls with default cloneSize bins:

clonalHomeostasis(combined.TCR, 
                  cloneCall = "gene")

We can reassign the proportional cut points for cloneSize, which can drastically alter the visualization and analysis

clonalHomeostasis(combined.TCR, 
                  cloneCall = "gene",
                  cloneSize = c(Rare = 0.001, Small = 0.01, Medium = 0.1, 
                                Large = 0.3, Hyperexpanded = 1))

In addition, we can use the group.by parameter to look at the relative proportion of clones between groups, such as by tissue type. First, ensure the “Type” variable is added to combined.TCR:

combined.TCR <- addVariable(combined.TCR, 
                            variable.name = "Type", 
                            variables = rep(c("B", "L"), 4))

Now, visualize clonal homeostasis grouped by “Type”:

clonalHomeostasis(combined.TCR, 
                  group.by = "Type",
                  cloneCall = "gene")

clonalHomeostasis() provides an assessment of how different “sizes” of clones (based on their proportional abundance) contribute to the overall repertoire. This visualization helps to identify shifts in repertoire structure, such as expansion of large clones in response to infection or contraction in chronic conditions, offering insights into immune system activity and health.

5.2 clonalProportion: Examining Space Occupied by Ranks of Clones

Like clonal space homeostasis, clonalProportion() also categorizes clones into separate bins. The key difference is that instead of looking at the relative proportion of the clone to the total, clonalProportion() ranks the clones by their total count or frequency of occurrence and then places them into predefined bins.

The clonalSplit parameter represents the ranking of clonotypes. For example, 1:10 refers to the top 10 clonotypes in each sample. The default bins are set under the clonalSplit variable and can be adjusted.

Default clonalSplit Bins

  • 10 (top 1-10 clones)
  • 100: (top 11-100 clones)
  • 1000: (top 101-1000 clones)
  • 10000: (top 1001-10000 clones)
  • 30000: (top 10001-30000 clones)
  • 100000: (top 30001-100000 clones)

To visualize the clonal proportion using gene clone calls with default clonalSplit bins:

clonalProportion(combined.TCR, 
                 cloneCall = "gene") 

To visualize clonal proportion using nt (nucleotide) clone calls with custom clonalSplit bins:

clonalProportion(combined.TCR, 
                 cloneCall = "nt",
                 clonalSplit = c(1, 5, 10, 100, 1000, 10000)) 

clonalProportion() complements clonalHomeostasis() by providing a perspective on how the “richest” (most abundant) clones contribute to the overall repertoire space. By segmenting clones into rank-based bins, it helps identify whether a few highly expanded clones or a larger number of moderately expanded clones dominate the immune response, offering distinct insights into repertoire structure and dynamics.


6 Summarizing Repertoires

6.1 percentGeneUsage

Gene quantification and visualization has been redesigned to offer a more robust and translatable function under percentGeneUsage(). We have maintained the functionality of the previous functions for gene-level quantification under the aliases vizGenes(), percentGenes(), and percentVJ().

6.1.1 vizGenes: Flexible Gene Usage Visualization

The vizGenes() function offers a highly adaptable approach to visualizing the relative usage of TCR or BCR genes. It acts as a versatile alias for percentGeneUsage(), allowing for comparisons across different chains, scaling of values, and selection between bar charts and heatmaps.

  • x.axis: Specifies the gene segment to display along the x-axis (e.g., “TRBV”, “TRBD”, “IGKJ”).
  • y.axis
    • Another gene segment (e.g., “TRAV”, “TRBJ”) for paired gene analysis. When x.axis and y.axis are both gene segments, vizGenes() internally calls percentGeneUsage() with genes = c(x.axis, y.axis), resulting in a heatmap.
    • A categorical variable (e.g., “sample”, “orig.ident”) to visualize gene usage across different groups. When y.axis is a categorical variable, vizGenes() maps it to the group.by parameter of percentGeneUsage(), creating facets for each category.
  • plot: Determines the visualization type:
    • “barplot”: Ideal for visualizing the distribution of a single gene segment.
    • “heatmap”: Suitable for single gene usage (with a group.by or y.axis categorical variable) or for paired gene analysis.
  • summary.fun: (Inherited from percentGeneUsage) Defines the statistic to display: “percent” (default), “proportion”, or “count”. This implicitly handles the scaling of values.
vizGenes(combined.TCR,
         x.axis = "TRBV",
         y.axis = NULL, # No specific y-axis variable, will group all samples
         plot = "barplot",
         summary.fun = "proportion") 

This plot shows the proportion of each TRBV gene segment observed across the entire combined.TCR dataset. Since y.axis is NULL, samples are grouped by the list element of the combined.TCR data.

vizGenes() is particularly useful for examining gene pairings. Let’s look at the differences in TRBV and TRBJ usage between peripheral blood and lung samples from your dataset. We’ll subset combined.TCR for this analysis.

# Peripheral Blood Samples
vizGenes(combined.TCR[c("P17B", "P18B", "P19B", "P20B")],
         x.axis = "TRBV",
         y.axis = "TRBJ",
         plot = "heatmap",
         summary.fun = "percent") # Display percentages

# Lung Samples
vizGenes(combined.TCR[c("P17L", "P18L", "P19L", "P20L")],
         x.axis = "TRBV",
         y.axis = "TRBJ",
         plot = "heatmap",
         summary.fun = "percent") # Display percentages

In these examples, by providing both x.axis and y.axis as gene segments (“TRBV” and “TRBJ”), vizGenes() automatically performs a paired gene analysis, generating a heatmap where the intensity reflects the percentage of each V-J pairing.

Beyond V-J pairings within a single chain, vizGenes() can also visualize gene usage across different chains. For instance, to examine TRBV and TRAV pairings for patient P17’s samples:

vizGenes(combined.TCR[c("P17B", "P17L")],
         x.axis = "TRBV",
         y.axis = "TRAV",
         plot = "heatmap",
         summary.fun = "count") 

6.1.2 percentGenes: Quantifying Single Gene Usage

The percentGenes() function is a specialized alias for percentGeneUsage() designed to quantify the usage of a single V, D, or J gene locus for a specified immune receptor chain. By default, it returns a heatmap visualization.

Key Parameters for percentGenes():

  • chain: Specifies the immune receptor chain (e.g., “TRB”, “TRA”, “IGH”, “IGL”).
  • gene: Indicates the gene locus to quantify: “Vgene”, “Dgene”, or “Jgene”.
  • group.by, order.by, summary.fun, exportTable, palette: These parameters are directly passed to percentGeneUsage().

To quantify and visualize the percentage of TRBV gene usage across your samples:

percentGenes(combined.TCR,
             chain = "TRB",
             gene = "Vgene",
             summary.fun = "percent")

This generates a heatmap showing the percentage of each TRBV gene segment within each sample, allowing for easy visual comparison of gene usage profiles across your samples.

The raw data returned by percentGenes() (when exportTable = TRUE) can be a powerful input for further downstream analysis, such as dimensionality reduction techniques like Principal Component Analysis. This allows you to summarize the complex gene usage patterns and identify samples with similar or distinct repertoires.

df.genes <- percentGenes(combined.TCR,
                         chain = "TRB",
                         gene = "Vgene",
                         exportTable = TRUE,
                         summary.fun = "proportion") 

# Performing PCA on the gene usage matrix
pc <- prcomp(t(df.genes) )

# Getting data frame to plot from
df_plot <- as.data.frame(cbind(pc$x[,1:2], colnames(df.genes)))
colnames(df_plot) <- c("PC1", "PC2", "Sample")
df_plot$PC1 <- as.numeric(df_plot$PC1)
df_plot$PC2 <- as.numeric(df_plot$PC2)

ggplot(df_plot, aes(x = PC1, y = PC2)) +
  geom_point(aes(fill = Sample), shape = 21, size = 5) +
  guides(fill=guide_legend(title="Samples")) +
  scale_fill_manual(values = hcl.colors(nrow(df_plot), "inferno")) +
  theme_classic() +
  labs(title = "PCA of TRBV Gene Usage")

This PCA plot visually clusters samples based on their TRBV gene usage profiles, helping to identify underlying patterns or relationships between samples.

6.1.3 percentVJ: Quantifying V-J Gene Pairings

The percentVJ() function is another specialized alias for percentGeneUsage(), specifically designed to quantify the proportion or percentage of V and J gene segments paired together within individual repertoires. It always produces a heatmap visualization.

Key Parameters for percenVJ():

  • chain: Specifies the immune receptor chain (e.g., “TRB”, “TRA”, “IGH”, “IGL”). This dictates which V and J gene segments are analyzed (e.g., TRBV and TRBJ for chain = “TRB”)
percentVJ(combined.TCR[1:2],
          chain = "TRB",
          summary.fun = "percent")

This heatmap displays the percentage of each TRBV-TRBJ pairing for each sample, providing a detailed view of the V-J recombination landscape.

Similar to percentGenes(), the quantitative output of percentVJ() can be used for dimensionality reduction to summarize V-J pairing patterns across samples.

df.vj <- percentVJ(combined.TCR,
                   chain = "TRB",
                   exportTable = TRUE,
                   summary.fun = "proportion") # Export proportions for PCA

# Performing PCA on the V-J pairing matrix
pc.vj <- prcomp(t(df.vj))

# Getting data frame to plot from
df_plot_vj <- as.data.frame(cbind(pc.vj$x[,1:2], colnames(df.vj)))
colnames(df_plot_vj) <- c("PC1", "PC2", "Sample")
df_plot_vj$PC1 <- as.numeric(df_plot_vj$PC1)
df_plot_vj$PC2 <- as.numeric(df_plot_vj$PC2)

# Plotting the PCA results
ggplot(df_plot_vj, aes(x = PC1, y = PC2)) +
  geom_point(aes(fill = Sample), shape = 21, size = 5) +
  guides(fill=guide_legend(title="Samples")) +
  scale_fill_manual(values = hcl.colors(nrow(df_plot_vj), "inferno")) +
  theme_classic() +
  labs(title = "PCA of TRBV-TRBJ Gene Pairings")

6.2 percentAA: Amino Acid Composition by Residue

Quantify the proportion of amino acids along the CDR3 sequence with percentAA(). By default, the function will pad the sequences with NAs up to the maximum of aa.length. Sequences longer than aa.length will be removed before visualization (default aa.length = 20).

Key Parameter(s) for percentAA()

  • aa.length: The maximum length of the CDR3 amino acid sequence to consider.

To visualize the relative percentage of amino acids at each position of the CDR3 sequences for the TRB chain, up to a length of 20 amino acids:

percentAA(combined.TCR, 
          chain = "TRB", 
          aa.length = 20)

This plot displays the relative proportion of each amino acid at different positions across the CDR3 sequence for the specified chain. It provides insights into the amino acid composition and variability at each residue, which can be indicative of functional constraints or selection pressures on the CDR3

6.3 positionalEntropy: Entropy across CDR3 Sequences

We can also quantify the level of entropy/diversity across amino acid residues along the CDR3 sequence. positionalEntropy() combines the quantification by residue of percentAA() with diversity calculations. Positions without variance will have a value reported as 0 for the purposes of comparison.

Key Parameter(s) for positionalEntropy()

  • method
    • shannon - Shannon Index
    • inv.simpson - Inverse Simpson Index
    • gini.simpson - Gini-Simpson Index
    • norm.entropy - Normalized Entropy
    • pielou - Pielou’s Evenness
    • hill1, hill2, hill3 - Hill Numbers

To visualize the normalized entropy across amino acid residues for the TRB chain, up to a length of 20 amino acids:

positionalEntropy(combined.TCR, 
                  chain = "TRB", 
                  aa.length = 20)

The plot generated by positionalEntropy() illustrates the diversity or entropy at each amino acid position within the CDR3 sequence. Higher entropy values indicate greater variability in amino acid usage at that position, suggesting less selective pressure or more promiscuous binding, while lower values suggest conserved positions critical for structural integrity or antigen recognition.

6.4 positionalProperty: Amino Acid Properties across CDR3 Sequence

Like positionalEntropy(), we can also examine a series of amino acid properties along the CDR3 sequences using positionalProperty(). Important differences for positionalProperty() is dropping NA values as they would void the mean calculation and displaying a ribbon with the 95% confidence interval surrounding the mean value for the selected properties.

Key Parameter(s) for positionalEntropy()

To examine the Atchley factors of amino acids across the CDR3 sequence for the first two samples:

positionalProperty(combined.TCR[c(1,2)], 
                  chain = "TRB", 
                  aa.length = 20, 
                  method = "atchleyFactors") + 
  scale_color_manual(values = hcl.colors(5, "inferno")[c(2,4)])

This function provides a detailed view of how physicochemical properties of amino acids change along the CDR3 sequence. By visualizing the mean property value and its confidence interval, one can identify positions with distinct characteristics or significant variations between groups, offering insights into structural and functional aspects of the CDR3.

6.5 percentKmer: Motif Quantification

Another quantification of the composition of the CDR3 sequence is to define motifs by sliding across the amino acid or nucleotide sequences at set intervals, resulting in substrings or kmers.

Key Parameter(s) for percentKmer():

  • cloneCall: Defines the clonal sequence grouping; only accepts aa (amino acids) or nt (nucleotides)
  • motif.length: The length of the kmer to analyze.
  • top.motifs: Displays the n most variable motifs as a function of median absolute deviation.

To visualize the percentage of the top 25 most variable 3-mer amino acid motifs for the TRB chain:

percentKmer(combined.TCR, 
            cloneCall = "aa",
            chain = "TRB", 
            motif.length = 3, 
            top.motifs = 25)

To perform the same analysis but for nucleotide motifs:

percentKmer(combined.TCR, 
            cloneCall = "nt",
            chain = "TRB", 
            motif.length = 3, 
            top.motifs = 25)

The heatmaps generated by percentKmer() illustrate the relative composition of frequently occurring k-mer motifs across samples or groups. This analysis can highlight recurrent sequence patterns in the CDR3, which may be associated with specific antigen recognition, disease states, or processing mechanisms. By examining the most variable motifs, researchers can identify key sequence features that differentiate immune repertoires.


7 Comparing Clonal Diversity and Overlap

7.1 clonalDiversity: Clonal Diversity Quantification

Diversity can be measured for samples or by other variables. clonalDiversity() calculates a specified diversity metric for groups within a dataset. To control for variations in library size, the function can perform bootstrapping with downsampling. It resamples each group to the size of the smallest group and calculates the diversity metric across multiple iterations, returning the mean values.

7.1.1 How clonalDiversity() Handles Downsampling and Bootstrapping

  • It determines the number of clones in the smallest group.
  • For each group, it performs n.boots iterations (default = 100).
  • In each iteration, it randomly samples the clones (with replacement) down to the size of the smallest group.
  • It calculates the selected diversity metric on this downsampled set.
  • The final reported diversity value is the mean of the results from all bootstrap iterations.
  • This process can be disabled by setting skip.boots = TRUE.

7.1.2 Available Diversity Metrics (metric)

Metric What it measures Typical scale Higher value indicates…
shannon Joint richness + evenness of clonotypes; moderately sensitive to rare clones (entropy of the frequency distribution). 0 → ∞ More distinct clonotypes and a more even clone-size distribution.
inv.simpson Evenness-weighted diversity (inverse Simpson’s D); heavily penalises dominance by a few large clones. 1 → ∞ Few highly dominant clones; diversity spread across many mid-abundance clones.
norm.entropy Shannon entropy divided by ln S (where S = no. clonotypes); removes library-size dependence. 0 → 1 Same interpretation as shannon, but comparable across samples of different depths.
gini.simpson 1 – Simpson’s D; probability that two reads drawn at random come from different clonotypes. 0 → 1 Greater heterogeneity (higher chance the two reads represent distinct clones).
chao1 Estimated richness only (number of clonotypes), correcting for unseen singletons/doubletons. 0 → ∞ More unique clonotypes, regardless of their relative abundances.
ACE Abundance-based Coverage Estimator—alternative richness estimator robust when many clones are rare. 0 → ∞ More unique clonotypes, especially when the repertoire contains many low-frequency clones.
gini Inequality of clone size distribution (Gini Coefficient); measures how unevenly clone sizes are distributed. 0 → 1 Greater inequality; a few highly abundant clones dominate the repertoire.
d50 Repertoire dominance; how many of the top clones are needed to constitute 50% of the total library. 1 → ∞ Less dominance by top clones; the repertoire is more evenly distributed.
hill0 Richness (Hill number q=0); the total number of unique clonotypes observed in the sample. 0 → ∞ More unique clonotypes (greater raw richness).
hill1 Effective number of abundant clonotypes (Hill number q=1); the exponential of Shannon entropy. 1 → ∞ Higher diversity of common clonotypes, balancing richness and evenness.
hill2 Effective number of dominant clonotypes (Hill number q=2); equivalent to the inverse Simpson index. 1 → ∞ Higher diversity among the most dominant clonotypes in the repertoire.

Key Parameters for clonalDiversity()

  • metric: The diversity metric to calculate.
  • x.axis: An additional metadata variable to group samples along the x-axis.
  • return.boots: If TRUE, returns all bootstrap values instead of the mean.
  • skip.boots: If TRUE, disables downsampling and bootstrapping.
  • n.boots: The number of bootstrap iterations to perform (default is 100).

To calculate Shannon diversity, grouped by sample:

clonalDiversity(combined.TCR, 
                cloneCall = "gene")

There are two options for grouping in clonalDiversity(): group.by and x.axis.

  • group.by: Reorganizes the clone information into new groups that the calculation will be based on.
  • x.axis: Keeps the organization of the clone information the same, but plots along the x-axis for improved visibility or grouping.

First, add a “Patient” variable to combined.TCR

combined.TCR <- addVariable(combined.TCR, 
                            variable.name = "Patient", 
                             variables = c("P17", "P17", "P18", "P18", 
"P19","P19", "P20", "P20"))

Now, calculate Inverse Simpson diversity, grouped by “Patient”:

clonalDiversity(combined.TCR, 
                cloneCall = "gene", 
                group.by = "Patient", 
                metric = "inv.simpson")

Calculate Inverse Simpson diversity with “Patient” on the x-axis, keeping the original grouping:

clonalDiversity(combined.TCR, 
                cloneCall = "gene", 
                x.axis = "Patient", 
                metric = "inv.simpson")

clonalDiversity() functions in quantifying and comparing the diversity of immune repertoires across different samples or experimental conditions. By implementing bootstrapping and offering a wide range of diversity metrics, it provides robust and comparable measures of clonal richness and evenness, which are fundamental for understanding immune responses and disease states

7.2 clonalRarefaction: Sampling-based Extrapolation

clonalRarefaction() uses Hill numbers to estimate rarefaction, or estimating species richness, based on the abundance of clones across groupings. The underlying rarefaction calculation uses the observed receptor abundance to compute diversity. This function relies on the iNEXT R package.

7.2.1 Hill Numbers and Their Interpretation

  • 0: Species richness
  • 1: Shannon Diversity
  • 2: Simpson Diversity

7.2.2 plot.type Options

  • 1: Sample-size-based rarefaction/extrapolation curve
  • 2: Sample completeness curve
  • 3: Coverage-based rarefaction/extrapolation curve

Key Parameter(s) for clonalRarefaction()

  • plot.type: The type of plot to generate.
  • hill.numbers: The Hill numbers to be plotted (0, 1, or 2).
  • n.boots: The number of bootstrap replicates used to derive confidence intervals (default is 20).

This function relies on the iNEXT with the accompanying manuscript. Like the other wrapping functions in scRepertoire, please cite the original work. The sample completeness curve (plot.type = 2), may not show full sample coverage due to the size/diversity of the input data.

7.2.3 Rarefaction using Species Richness (q = 0)

clonalRarefaction(combined.TCR,
                  plot.type = 1,
                  hill.numbers = 0,
                  n.boots = 2)

clonalRarefaction(combined.TCR,
                  plot.type = 2,
                  hill.numbers = 0,
                  n.boots = 2)

clonalRarefaction(combined.TCR,
                  plot.type = 3,
                  hill.numbers = 0,
                  n.boots = 2)

7.2.4 Rarefaction using Shannon Diversity (q = 1)

clonalRarefaction(combined.TCR,
                  plot.type = 1,
                  hill.numbers = 1,
                  n.boots = 2)

clonalRarefaction(combined.TCR,
                  plot.type = 2,
                  hill.numbers = 1,
                  n.boots = 2)

clonalRarefaction(combined.TCR,
                  plot.type = 3,
                  hill.numbers = 1,
                  n.boots = 2)

clonalRarefaction() provides robust estimates of immune repertoire diversity, allowing for comparison of richness and effective diversity across samples, even with varying sequencing depths. By visualizing rarefaction and extrapolation curves, researchers can assess the completeness of their sampling and make fair comparisons of diversity, which is essential for understanding immune complexity.

7.3 clonalSizeDistribution: Modeling Clonal Composition

Another method for modeling the repertoire distribution is a discrete gamma-GPD spliced threshold model, proposed by Koch et al. The spliced model models the repertoire and allows for the application of a power law distribution for larger clonal-expanded sequences and a Poisson distribution for smaller clones. After fitting the models, repertoires can be compared using Euclidean distance. If using this function, please read/cite Koch et al. and check out the powerTCR R package.

Key Parameter(s) for clonalSizeDistribution()

  • method: The agglomeration method for hierarchical clustering (e.g., “ward.D2”).

To model the clonal size distribution using amino acid clone calls and hierarchical clustering with the “ward.D2” method:

clonalSizeDistribution(combined.TCR, 
                       cloneCall = "aa", 
                       method= "ward.D2")

clonalSizeDistribution() offers a sophisticated approach to modeling immune repertoire composition, distinguishing between the distribution of rare and expanded clones. By applying a spliced statistical model, it provides a more accurate representation of the repertoire’s underlying clonal architecture, enabling robust comparisons and a deeper understanding of immune system dynamics.

7.4 clonalOverlap: Exploring Sequence Overlap

If you are interested in measures of similarity between the samples loaded into scRepertoire, using clonalOverlap() can assist in the visualization. The underlying clonalOverlap() calculation varies by the method parameter.

7.4.1 method Parameters for clonalOverlap()

  • overlap - Overlap coefficient
  • morisita - Morisita’s overlap index
  • jaccard - Jaccard index
  • cosine - Cosine similarity
  • raw - Exact number of overlapping clones

To calculate and visualize the Morisita overlap index using strict clone calls:

clonalOverlap(combined.TCR, 
              cloneCall = "strict", 
              method = "morisita")

To calculate and visualize the raw number of overlapping clones using strict clone calls:

clonalOverlap(combined.TCR, 
              cloneCall = "strict", 
              method = "raw")

clonalOverlap() is a tool for assessing the similarity and shared clonotypes between different immune repertoires. By offering various quantitative methods and a clear heatmap visualization, it allows researchers to identify the degree of overlap, providing insights into shared immune responses, cross-reactivity, or the impact of different treatments on clonal composition.


8 Combining Clones and Single-Cell Objects

The data in the scRepertoire package is derived from a study of acute respiratory stress disorder in the context of bacterial and COVID-19 infections. The internal single cell data (scRep_example()) built in to scRepertoire is randomly sampled 500 cells from the fully integrated Seurat object to minimize the package size. We will use both Seurat and Single-Cell Experiment (SCE) with scater to perform further visualizations in tandem.

8.1 Preprocessed Single-Cell Object

scRep_example <- get(data("scRep_example"))

#Making a Single-Cell Experiment object
sce <- Seurat::as.SingleCellExperiment(scRep_example)

#Adding patient information
scRep_example$Patient <- substr(scRep_example$orig.ident, 1,3)

#Adding type information
scRep_example$Type <- substr(scRep_example$orig.ident, 4,4)

8.2 Note on Dimensional Reduction

In single-cell RNA sequencing workflows, dimensional reduction is typically performed by first identifying highly variable features. These features are then used directly for UMAP/tSNE projection or as inputs for principal component analysis. The same approach is commonly applied to clustering as well.

However, in immune-focused datasets, VDJ genes from TCR and BCR are often among the most variable genes. This variability arises naturally due to clonal expansion and diversity within lymphocytes. As a result, UMAP projections and clustering outcomes may be influenced by clonal information rather than broader transcriptional differences across cell types.

To mitigate this issue, a common strategy is to exclude VDJ genes from the set of highly variable features before proceeding with clustering and dimensional reduction. We introduce a set of functions that facilitate this process by removing VDJ-related genes from either a Seurat Object or a vector of gene names (useful for SCE-based workflows).

8.2.1 Functions to Exclude VDJ Genes

  • quietVDJgenes() – Removes both TCR and BCR VDJ genes.
  • quietTCRgenes() – Removes only TCR VDJ genes.
  • quietBCRgenes() – Removes only BCR VDJ genes, but retains BCR VDJ pseudogenes in the variable features.

Let’s first check the top 10 variable features in the scRep_example Seurat object before any removal:

# Check the first 10 variable features before removal
VariableFeatures(scRep_example)[1:10]
##  [1] "TRBV7-2"  "HSPA1B"   "HSPA1A"   "TRBV4-1"  "CCL4"     "TRBV5-1" 
##  [7] "TRBV10-3" "TRBV3-1"  "TRBV6-6"  "CD79A"

Now, we’ll remove TCR VDJ genes from the scRep_example object:

# Remove TCR VDJ genes
scRep_example <- quietTCRgenes(scRep_example)

# Check the first 10 variable features after removal
VariableFeatures(scRep_example)[1:10]
##  [1] "HSPA1B"  "HSPA1A"  "CCL4"    "CD79A"   "HLA-DRA" "CCL20"   "TUBA1B" 
##  [8] "HSPA6"   "TNF"     "MS4A1"

By applying these functions, you can ensure that clustering and dimensional reduction are driven by broader transcriptomic differences across cell types rather than being skewed by the inherent variability due to clonal expansion. This provides a more accurate representation of cellular heterogeneity independent of clonal lineage.

8.3 Preprocessed Single-Cell Object

The data in the scRepertoire package is derived from a study of acute respiratory stress disorder in the context of bacterial and COVID-19 infections. The internal single cell data (scRep_example()) built in to scRepertoire is randomly sampled 500 cells from the fully integrated Seurat object to minimize the package size. However, for the purpose of the vignette we will use the full single-cell object with 30,000 cells. We will use both Seurat and Single-Cell Experiment (SCE) with scater to perform further visualizations in tandem.

8.4 combineExpression

After processing the contig data into clones via combineBCR() or combineTCR(), we can add the clonal information to the single-cell object using combineExpression().

Importantly, the major requirement for the attachment is matching contig cell barcodes and barcodes in the row names of the metadata of the Seurat or Single-Cell Experiment object. If these do not match, the attachment will fail. We suggest making changes to the single-cell object barcodes for ease of use.

8.4.1 Calculating cloneSize

Part of combineExpression() is calculating the clonal frequency and proportion, placing each clone into groups called cloneSize. The default cloneSize argument uses the following bins: c(Rare = 1e-4, Small = 0.001, Medium = 0.01, Large = 0.1, Hyperexpanded = 1), which can be modified to include more/less bins or different names.

Clonal frequency and proportion are dependent on the repertoires being compared. You can modify the calculation using the group.by parameter, such as grouping by a Patient variable. If group.by is not set, combineExpression() will calculate clonal frequency, proportion, and cloneSize as a function of individual sequencing runs. Additionally, cloneSize can use the frequency of clones when proportion = FALSE.

Key Parameter(s) for combineExpression()

  • input.data: The product of combineTCR(), combineBCR(), or a list containing both.
  • sc.data: The Seurat or Single-Cell Experiment (SCE) object to attach the clonal data to.
  • proportion: If TRUE (default), calculates the proportion of the clone; if FALSE, calculates total frequency.
  • cloneSize: Bins for grouping based on proportion or frequency. If proportion is FALSE and cloneSize bins are not set high enough, the upper limit will automatically adjust.
  • filterNA: Method to subset the Seurat/SCE object of barcodes without clone information.
  • addLabel: Adds a label to the frequency header, useful for trying multiple group.by variables or recalculating frequencies after subsetting.

We can look at the default cloneSize groupings using the Single-Cell Experiment object we just created, with group.by set to the sample variable used in combineTCR():

sce <- combineExpression(combined.TCR, 
                         sce, 
                         cloneCall="gene", 
                         group.by = "sample", 
                         proportion = TRUE)

#Define color palette 
colorblind_vector <- hcl.colors(n=7, palette = "inferno", fixup = TRUE)

plotUMAP(sce, colour_by = "cloneSize") +
    scale_color_manual(values=rev(colorblind_vector[c(1,3,5,7)]))

Alternatively, if we want cloneSize to be based on the frequency of the clone, we can set proportion = FALSE and will need to change the cloneSize bins to integers. If we haven’t inspected our clone data, setting the upper limit of the clonal frequency might be difficult; combineExpression() will automatically adjust the upper limit to fit the distribution of the frequencies.

scRep_example <- combineExpression(combined.TCR, 
                                   scRep_example, 
                                   cloneCall="gene", 
                                   group.by = "sample", 
                                   proportion = FALSE, 
                                   cloneSize=c(Single=1, Small=5, Medium=20, Large=100, Hyperexpanded=500))

# Bug in Seurat 5.3.1 no longer handles NA for DimPlot
# Will Update in Future Commits

# Seurat::DimPlot(scRep_example, group.by = "cloneSize") +
#    scale_color_manual(values=rev(colorblind_vector[c(1,3,4,5,7)]))

8.4.2 Combining both TCR and BCR

If you have both TCR and BCR enrichment data, or wish to include information for both gamma-delta and alpha-beta T cells, you can create a single list containing the outputs of combineTCR() and combineBCR() and then use combineExpression().

Major Note: If there are duplicate barcodes (e.g., if a cell has both Ig and TCR information), the immune receptor information will not be added for those cells. It might be worth checking cluster identities and removing incongruent barcodes in the products of combineTCR() and combineBCR(). As an anecdote, the testing data used to improve this function showed 5-6% barcode overlap.

#This is an example of the process, which will not be evaluated during knit
TCR <- combineTCR(...)
BCR <- combineBCR(...)
list.receptors <- c(TCR, BCR)


seurat <- combineExpression(list.receptors, 
                            seurat, 
                            cloneCall="gene", 
                            proportion = TRUE)

combineExpression() is a core function in scRepertoire that bridges the immune repertoire data with single-cell gene expression data. It enriches your Seurat or SCE object with crucial clonal information, including calculated frequencies and proportions, allowing for integrated analysis of cellular identity and clonal dynamics. Its flexibility in defining cloneSize and handling various grouping scenarios makes it adaptable to diverse experimental designs, even accommodating the integration of both TCR and BCR data.


9 Visualizations for Single-Cell Objects

9.1 clonalOverlay

Using the dimensional reduction graphs as a reference, clonalOverlay() generates an overlay of the positions of clonally-expanded cells. It highlights areas of high clonal frequency or proportion on your UMAP or tSNE plots.

Key Parameters for clonalOverlay()

  • sc.data: The single-cell object aftercombineExpression().
  • reduction: The dimensional reduction to visualize (e.g., “umap”, “pca”). Default is “pca”.
  • cut.category: The metadata variable to use for filtering the overlay (e.g., “clonalFrequency” or “clonalProportion”).
  • cutpoint: The lowest clonal frequency or proportion to include in the contour plot.
  • bins: The number of contours to draw.

clonalOverlay() can be used to look across all cells or faceted by a metadata variable using facet.by. The overall dimensional reduction will be maintained as we facet, while the contour plots will adjust based on the facet.by variable. The coloring of the dot plot is based on the active identity of the single-cell object.

This visualization was authored by Dr. Francesco Mazziotta and inspired by Drs. Carmona and Andreatta and their work with ProjectTIL, a pipeline for annotating T cell subtypes.

clonalOverlay(scRep_example, 
              reduction = "umap", 
              cutpoint = 1, 
              bins = 10, 
              facet.by = "Patient") + 
              guides(color = "none")

9.2 clonalNetwork

Similar to clonalOverlay(), clonalNetwork() visualizes the network interaction of clones shared between clusters along the single-cell dimensional reduction. This function shows the relative proportion of clones flowing from a starting node, with the ending node indicated by an arrow

9.2.1 Filtering Options for clonalNetwork()

  • filter.clones:
    • Select a number to isolate the clones comprising the top n number of cells (e.g., filter.clones = 2000).
    • Select min to scale all groups to the size of the minimum group.
  • filter.identity: For the identity chosen to visualize, show the “to” and “from” network connections for a single group.
  • filter.proportion: Remove clones from the network that comprise less than a certain proportion of clones in groups.
  • filter.graph: Remove reciprocal edges from one half of the graph, allowing for cleaner visualization.

Now, visualize the clonal network with no specific identity filter:

#ggraph needs to be loaded due to issues with ggplot
library(ggraph)

#No Identity filter
clonalNetwork(scRep_example, 
              reduction = "umap", 
              group.by = "seurat_clusters",
              filter.clones = NULL,
              filter.identity = NULL,
              cloneCall = "aa")

We can look at the clonal relationships relative to a single cluster using the filter.identity parameter. For example, focusing on Cluster 3:

#Examining Cluster 3 only
clonalNetwork(scRep_example, 
              reduction = "umap", 
              group.by = "seurat_clusters",
              filter.identity = 3,
              cloneCall = "aa")

You can also use the exportClones parameter to quickly get clones that are shared across multiple identity groups, along with the total number of clone copies in the dataset.

shared.clones <- clonalNetwork(scRep_example, 
                               reduction = "umap", 
                               group.by = "seurat_clusters",
                               cloneCall = "aa", 
                               exportClones = TRUE)
head(shared.clones)
## # A tibble: 6 × 2
##   clone                                sum
##   <fct>                              <int>
## 1 CVVSDNTGGFKTIF_CASSVRRERANTGELFF      11
## 2 CAELNQAGTALIF_CASSQAPFSTSGELFF         3
## 3 CASLSGSARQLTF_CASSSTVAGEQYF            3
## 4 NA_CASSVRRERANTGELFF                   3
## 5 CAERGSGGSYIPTF_CASSDPSGRQGPRWDTQYF     2
## 6 CAGAAETSGSRLTF_CASSRLRTGALYEQYF        2

9.3 highlightClones

The highlightClones() function allows you to specifically visualize the distribution of particular clonal sequences on your single-cell dimensional reduction plots. This helps in tracking the location and expansion of clones of interest.

Key Parameters for highlightClones()

  • cloneCall: The type of sequence to use for highlighting (e.g., “aa”, “nt”, “strict”).
  • sequence: A character vector of the specific clonal sequences to highlight.

To highlight the most prominent amino acid sequences: CAERGSGGSYIPTF_CASSDPSGRQGPRWDTQYF and CARKVRDSSYKLIF_CASSDSGYNEQFF:

scRep_example <- highlightClones(scRep_example, 
                    cloneCall= "aa", 
                    sequence = c("CAERGSGGSYIPTF_CASSDPSGRQGPRWDTQYF", 
                                 "CARKVRDSSYKLIF_CASSDSGYNEQFF"))

# Bug in Seurat 5.3.1 no longer handles NA for DimPlot
# Will Update in Future Commits

# Seurat::DimPlot(scRep_example, group.by = "highlight") + 
#   guides(color=guide_legend(nrow=3,byrow=TRUE)) + 
#   ggplot2::theme(plot.title = element_blank(), 
#                 legend.position = "bottom")

9.4 clonalOccupy

clonalOccupy() visualizes the count of cells by cluster, categorized into specific clonal frequency ranges. It uses the cloneSize metadata variable (generated by combineExpression()) to plot the number of cells within each clonal expansion designation, using a secondary variable like cluster. Credit for the idea goes to Drs. Carmona and Andreatta.

Key Parameters for clonalOccupy() * x.axis: The variable in the metadata to graph along the x-axis (e.g., “seurat_clusters”, “ident”). * label: If TRUE, includes the number of clones in each category by x.axis variable. * proportion: If TRUE, converts the stacked bars into relative proportions. * na.include: If TRUE, visualizes NA values.

To visualize the count of cells by seurat_clusters based on cloneSize groupings:

clonalOccupy(scRep_example, 
              x.axis = "seurat_clusters")

To visualize the proportion of cells by ident (active identity), without labels:

clonalOccupy(scRep_example, 
             x.axis = "ident", 
             proportion = TRUE, 
             label = FALSE)

9.5 alluvialClones

After the metadata has been modified with clonal information, alluvialClones() allows you to look at clones across multiple categorical variables, enabling the examination of the interchange between these variables. Because this function produces a graph with each clone arranged by called stratification, it may take some time depending on the size of the repertoire.

Key Parameters for alluvialClones()

  • y.axes: The columns that will separate the proportional visualizations.
  • color: The column header or clone(s) to be highlighted.
  • facet: The column label to separate facets.
  • alpha: The column header to have gradated opacity.
  • top.clones: Show only the top N clones by frequency.
  • min.freq: Minimum frequency threshold for displaying flows.
  • highlight.clones: Character vector of specific clone sequences to highlight.
  • highlight.color: Color to use for highlighted clones (default: “red”).

9.5.1 Basic Alluvial Plot

To visualize clonal flow across “Patient”, “ident”, and “Type”, highlighting specific amino acid clones:

alluvialClones(scRep_example,
               clone.call = "aa",
               y.axes = c("Patient", "ident", "Type"),
               color = c("CVVSDNTGGFKTIF_CASSVRRERANTGELFF", "NA_CASSVRRERANTGELFF")) +
    scale_fill_manual(values = c("grey", colorblind_vector[3]))

To visualize clonal flow across “Patient”, “ident”, and “Type”, coloring by “ident”:

alluvialClones(scRep_example,
               clone.call = "gene",
               y.axes = c("Patient", "ident", "Type"),
               color = "ident")

9.5.2 Filtering to Top Clones

When working with large repertoires, it can be helpful to focus on the most frequent clones. The top.clones parameter allows you to filter to the top N clones:

alluvialClones(scRep_example,
               clone.call = "aa",
               y.axes = c("Patient", "ident"),
               top.clones = 25,
               color = "ident")

9.5.3 Highlighting Specific Clones

Use highlight.clones to call out specific clones of interest while showing the context of other clones:

alluvialClones(scRep_example,
               clone.call = "aa",
               y.axes = c("Patient", "ident", "Type"),
               highlight.clones = c("CVVSDNTGGFKTIF_CASSVRRERANTGELFF"),
               highlight.color = "red")

9.5.4 Visual Customization

Fine-tune the appearance with parameters like stratum.width, flow.alpha, and label.size:

alluvialClones(scRep_example,
               clone.call = "gene",
               y.axes = c("Patient", "ident"),
               color = "ident",
               stratum.width = 0.3,
               flow.alpha = 0.7,
               label.size = 3)

alluvialClones() provides a visual representation of clonal distribution and movement across multiple categorical annotations. It is particularly effective for tracking how specific clones or clonal groups transition between different states, tissues, or cell types, offering a dynamic perspective on immune repertoire evolution and function.

9.6 getCirclize and vizCirclize

Like alluvial graphs, we can also visualize the interconnection of clusters using chord diagrams from the circlize R package. scRepertoire provides two functions for this:

  • getCirclize() - Generates data for use with the circlize package
  • vizCirclize() - A convenient wrapper that handles the circlize plotting automatically

These functions calculate the relative number of unique and shared clones based on the group.by variable using the product of combineExpression(). If using the downstream circlize R package, please read and cite the following manuscript.

Key Parameters for getCirclize() and vizCirclize()

  • group.by: A column header (or vector of column headers for hierarchical grouping).
  • method: The method for calculating link values: "unique" (default), "jaccard", or "overlap".
  • proportion: If TRUE, normalizes the relationship by proportion; if FALSE (default), uses unique clone counts.
  • include.self: If TRUE, includes counting clones within a single group comparison.
  • min.shared: Minimum number of shared clones to include a link.

9.6.1 Quick Visualization with vizCirclize

The simplest way to create a chord diagram is using vizCirclize():

library(circlize)
library(scales)

vizCirclize(scRep_example,
            group.by = "seurat_clusters",
            clone.call = "aa")

9.6.2 Manual Control with getCirclize

For more control over the visualization, use getCirclize() to generate the data and then plot with circlize directly. By default, getCirclize() returns a simple data frame:

circles <- getCirclize(scRep_example,
                       group.by = "seurat_clusters")

#Just assigning the normal colors to each cluster
grid.cols <- hue_pal()(length(unique(scRep_example$seurat_clusters)))
names(grid.cols) <- unique(scRep_example$seurat_clusters)

#Graphing the chord diagram
chordDiagram(circles, self.link = 1, grid.col = grid.cols)

9.6.3 Multi-Level Hierarchical Grouping

A powerful feature is the ability to create hierarchical groupings by passing a vector of column names to group.by. This creates compound sector labels:

vizCirclize(scRep_example,
            group.by = c("Patient", "Type"),
            clone.call = "aa",
            min.shared = 1)

9.6.4 Directional Flow

Show the direction of clonal sharing with arrows:

vizCirclize(scRep_example,
            group.by = "seurat_clusters",
            clone.call = "aa",
            directional = TRUE)

9.6.5 Different Similarity Methods

Use different methods for calculating link values:

# Jaccard similarity
circles.jaccard <- getCirclize(scRep_example,
                               group.by = "seurat_clusters",
                               method = "jaccard",
                               include.metadata = TRUE)

# The include.metadata option returns sector statistics
head(circles.jaccard$sector.stats)
## NULL

9.6.6 Subsetting and Proportion

This can also be used if we want to explore just the lung-specific T cells by subsetting the single-cell object. For the sake of this vignette, we can also look at setting proportion = TRUE to get a scaled output.

subset <- subset(scRep_example, Type == "L")

circles <- getCirclize(subset, group.by = "ident", proportion = TRUE)

grid.cols <- scales::hue_pal()(length(unique(subset@active.ident)))
names(grid.cols) <- levels(subset@active.ident)

chordDiagram(circles,
             self.link = 1,
             grid.col = grid.cols,
             directional = 1,
             direction.type = "arrows",
             link.arr.type = "big.arrow")

getCirclize() and vizCirclize() facilitate the creation of visually striking and informative chord diagrams to represent shared clonal relationships between distinct groups within your single-cell data. By providing a flexible way to quantify and format clonal overlap, they enable researchers to effectively illustrate complex clonal connectivity patterns, which are crucial for understanding immune communication and migration.


10 Quantifying Clonal Bias

10.1 StartracDiversity

From the excellent work by Zhang et al. (2018, Nature), the authors introduced new methods for looking at clones by cellular origins and cluster identification. We strongly recommend you read and cite their publication when using this function.

To use the StartracDiversity() function, you need the output of the combineExpression() function and a column in your metadata that specifies the tissue of origin.

10.1.1 Indices Output from StartracDiversity()

  • expa - Clonal Expansion. Measures the degree of clonal proliferation within a given cell cluster. It is calculated as 1 - normalized Shannon entropy, where a higher value indicates that a few clones dominate the cluster.
  • migr - Cross-tissue Migration. Quantifies the movement of clonal T cells between different tissues, as defined by the type parameter. This index is based on the entropy of a single clonotype’s distribution across the specified tissues.
  • tran - State Transition. Measures the developmental transition of T cell clones between different functional clusters. This index is calculated from the entropy of a single clonotype’s distribution across the cell clusters identified in the data.

Key Parameters for StartracDiversity()

  • type: The variable in the metadata that provides tissue type.
  • group.by: A column header in the metadata to group the analysis by (e.g., “sample”, “treatment”).

By default, StartracDiversity() will calculate all three indices (expa, migr, and tran) for each cluster and group you define. This provides a comprehensive overview of the clonal dynamics in your dataset. The output is a three-paneled plot, with each panel representing one index.

In the example data, type corresponds to the “Type” column, which includes “P” (peripheral blood) and “L” (lung) classifiers. The analysis is grouped by the “Patient” column.

# Calculate and plot all three STARTRAC indices
StartracDiversity(scRep_example, 
                  type = "Type", 
                  group.by = "Patient")

10.1.2 Calculating a Single Index

If you’re only interested in one aspect of clonal dynamics, you can specify it using the index parameter. For example, to only calculate and plot clonal expansion:

# Calculate and plot only the clonal expansion index
StartracDiversity(scRep_example, 
                  type = "Type", 
                  group.by = "Patient",
                  index = "expa")

10.1.3 Pairwise Migration Analysis

Another feature of StartracDiversity() is the ability to perform pairwise comparisons. To specifically quantify the migration between two tissues (e.g., Lung vs. Periphery), set index = "migr" and tell the function which column to use for the comparison with pairwise = "Type".

# # Calculate pairwise migration between tissues
StartracDiversity(scRep_example, 
                  type = "Type", 
                  group.by = "Patient",
                  index = "migr",
                  pairwise = "Type")

10.2 clonalBias

A new metric proposed by Massimo et al, clonalBias(), like STARTRAC, is a clonal metric that seeks to quantify how individual clones are skewed towards a specific cellular compartment or cluster. A clone bias of 1 indicates that a clone is composed of cells from a single compartment or cluster, while a clone bias of 0 matches the background subtype distribution. Please read and cite the linked manuscript if using clonalBias()

Key Parameter(s) for clonalBias()

  • group.by: A column header in the metadata that bias will be based on.
  • split.by: The variable to use for calculating the baseline frequencies (e.g., “Type” for lung vs peripheral blood comparison)
  • n.boots: Number of bootstraps to downsample.
  • min.expand: Clone frequency cut-off for the purpose of comparison (default = 10).

Here we calculate and plot clonal bias using aa clone calls, splitting by “Patient” and grouping by “seurat_clusters”, with a minimum expansion of 5 and 10 bootstraps:

clonalBias(scRep_example, 
           cloneCall = "aa", 
           split.by = "Patient", 
           group.by = "seurat_clusters",
           n.boots = 10, 
           min.expand =5)


11 Clustering by Edit Distance

11.1 clonalCluster: Cluster by Sequence Similarity

The clonalCluster() function provides a powerful method to group clonotypes based on sequence similarity. It calculates the edit distance between CDR3 sequences and uses this information to build a network, identifying closely related clusters of T or B cell receptors. This functionality allows for a more nuanced definition of a “clone” that extends beyond identical sequence matches.

11.1.1 Core Concepts

The clustering process follows these key steps:

  • Sequence Selection: The function selects either the nucleotide (sequence = "nt") or amino acid (sequence = "aa") CDR3 sequences for a specified chain.
  • Distance Calculation: It calculates the edit distance between all pairs of sequences. By default, it also requires sequences to share the same V gene (use.v = TRUE).
  • Network Construction: An edge is created between any two sequences that meet the similarity threshold, forming a network graph.
  • Clustering: A graph-based clustering algorithm is run to identify connected components or communities within the network. By default, it identifies all directly or indirectly connected sequences as a single cluster (cluster.method = "components").
  • Output: The function can either add the resulting cluster IDs to the input object, return an igraph object for network analysis, or export a sparse adjacency matrix.

11.1.2 Understanding the threshold Parameter

The behavior of the threshold parameter is critical for controlling cluster granularity:

  • Normalized Similarity (threshold < 1): When the threshold is a value between 0 and 1 (e.g., 0.85), it represents the normalized edit distance (Levenshtein distance / mean sequence length). A higher value corresponds to a stricter similarity requirement. This is useful for comparing sequences of varying lengths.
  • Raw Edit Distance (threshold >= 1): When the threshold is a whole number (e.g., 2), it represents the maximum raw edit distance allowed. A lower value corresponds to a stricter similarity requirement. This is useful when you want to allow a specific number of mutations.

Key Parameter(s) for clonalCluster()

  • sequence: Specifies whether to cluster based on aa (amino acid) or nt (nucleotide) sequences.
  • threshold: The similarity threshold for clustering. Values < 1 are normalized similarity, while values >= 1 are raw edit distance.
  • group.by: A column header in the metadata or lists to group the analysis by (e.g., “sample”, “treatment”). If NULL, clusters are calculated across all sequences.
  • use.V: If TRUE, sequences must share the same V gene to be clustered together.
  • use.J: If TRUE, sequences must share the same J gene to be clustered together.
  • cluster.method: The clustering algorithm to use. Defaults to components, which finds connected subgraphs.
  • cluster.prefix: A character prefix to add to the cluster names (e.g., “cluster.”).
  • exportGraph: If TRUE, returns an igraph object of the sequence network.
  • exportAdjMatrix: If TRUE, returns a sparse adjacency matrix (dgCMatrix) of the network.

11.1.3 Demonstrating Basic Use

To run clustering on the first two samples for the TRA chain, using amino acid sequences with a normalized similarity threshold of 0.85:

# Run clustering on the first two samples for the TRA chain
sub_combined <- clonalCluster(combined.TCR[c(1,2)], 
                              chain = "TRA", 
                              sequence = "aa", 
                              threshold = 0.85)

# View the new cluster column
head(sub_combined[[1]][, c("barcode", "TCR1", "TRA.Cluster")])
##                   barcode TCR1 TRA.Cluster
## 1 P17B_AGCGGTCCAAAGGAAG-1 <NA>        <NA>
## 2 P17B_GGCTCGAGTCGCGGTT-1 <NA>        <NA>
## 3 P17B_CGCGTTTTCGGCTACG-1 <NA>        <NA>
## 4 P17B_CACCAGGGTTCCTCCA-1 <NA>        <NA>
## 5 P17B_TCTATTGCAGGTGCCT-1 <NA>        <NA>
## 6 P17B_GCTGGGTGTACGAAAT-1 <NA>        <NA>

11.1.4 Demonstrating Clustering with a Single-Cell Object

You can calculate clusters based on specific metadata variables within a single-cell object by using the group.by parameter. This is useful for analyzing clusters on a per-sample or per-patient basis without subsetting the data first.

First, add patient and type information to the scRep_example Seurat object:

#Adding patient information
scRep_example$Patient <- substr(scRep_example$orig.ident, 1,3)

#Adding type information
scRep_example$Type <- substr(scRep_example$orig.ident, 4,4)

Now, run clustering on the scRep_example Seurat object, grouping calculations by “Patient”:

# Run clustering, but group calculations by "Patient"
scRep_example <- clonalCluster(scRep_example, 
                               chain = "TRA", 
                               sequence = "aa", 
                               threshold = 0.85, 
                               group.by = "Patient")

#Define color palette 
num_clusters <- length(unique(na.omit(scRep_example$TRA.Cluster)))
cluster_colors <- hcl.colors(n = num_clusters, palette = "inferno")

# Bug in Seurat 5.3.1 no longer handles NA for DimPlot
# Will Update in Future Commits

# DimPlot(scRep_example, group.by = "TRA.Cluster") +
#  scale_color_manual(values = cluster_colors, na.value = "grey") + 
#  NoLegend()

11.1.5 Returning an igraph Object:

Instead of modifying the input object, clonalCluster() can export the underlying network structure for advanced analysis. Set exportGraph = TRUE to get an igraph object consisting of the networks of barcodes by the indicated clustering scheme.

set.seed(42)
#Clustering Patient 19 samples
igraph.object <- clonalCluster(combined.TCR[c(5,6)],
                               chain = "TRB",
                               sequence = "aa",
                               group.by = "sample",
                               threshold = 0.85, 
                               exportGraph = TRUE)

#Setting color scheme
col_legend <- factor(igraph::V(igraph.object)$group)
col_samples <- hcl.colors(2,"inferno")[as.numeric(col_legend)]
color.legend <- factor(unique(igraph::V(igraph.object)$group))
sample.vertices <- V(igraph.object)[sample(length(igraph.object), 500)]

subgraph.object <- induced_subgraph(igraph.object, vids = sample.vertices)
V(subgraph.object)$degrees <- igraph::degree(subgraph.object)
edge_alpha_color <- adjustcolor("gray", alpha.f = 0.3)

#Plotting
plot(subgraph.object,
     layout = layout_nicely(subgraph.object),
     vertex.label = NA,
     vertex.size = sqrt(igraph::V(subgraph.object)$degrees), 
     vertex.color = col_samples[sample.vertices],
     vertex.frame.color = "white", 
     edge.color = edge_alpha_color,
     edge.arrow.size = 0.05,
     edge.curved = 0.05, 
     margin = -0.1)
legend("topleft", 
       legend = levels(color.legend), 
       pch = 16, 
       col = unique(col_samples), 
       bty = "n")

11.1.6 Returning a Sparse Adjacency Matrix

For computational applications, you can export a sparse adjacency matrix using exportAdjMatrix = TRUE. This matrix represents the connections between all barcodes in the input data, with the edit distance that meet the threshold in places of connection.

# Generate the sparse matrix
adj.matrix <- clonalCluster(combined.TCR[c(1,2)],
                            chain = "TRB",
                            exportAdjMatrix = TRUE)

# View the dimensions and a snippet of the matrix
dim(adj.matrix)
## [1] 5698 5698
print(adj.matrix[1:10, 1:10])
## 10 x 10 sparse Matrix of class "dgCMatrix"
##                                                      
## P17B_AGCGGTCCAAAGGAAG-1 . . . .      .      . . . . .
## P17B_GGCTCGAGTCGCGGTT-1 . . . .      .      . . . . .
## P17B_CGCGTTTTCGGCTACG-1 . . . .      .      . . . . .
## P17B_CACCAGGGTTCCTCCA-1 . . . .       1e-06 . . . . .
## P17B_TCTATTGCAGGTGCCT-1 . . .  1e-06 .      . . . . .
## P17B_GCTGGGTGTACGAAAT-1 . . . .      .      . . . . .
## P17B_AGGGTGACATTGGTAC-1 . . . .      .      . . . . .
## P17B_GGAACTTCATCGGTTA-1 . . . .      .      . . . . .
## P17B_ACGGCCACATCCGTGG-1 . . . .      .      . . . . .
## P17B_CACATAGTCCTAAGTG-1 . . . .      .      . . . . .

11.1.7 Using Both Chains

You can analyze the combined network of both TRA/TRB or IGH/IGL chains by setting chain = "both". This will create a single cluster column named Multi.Cluster.

# Cluster using both TRB and TRA chains simultaneously
clustered_both <- clonalCluster(combined.TCR[c(1,2)], 
                                chain = "both")

# View the new "Multi.Cluster" column
head(clustered_both[[1]][, c("barcode", "TCR1", "TCR2", "Multi.Cluster")])
##                   barcode TCR1                        TCR2 Multi.Cluster
## 1 P17B_AGCGGTCCAAAGGAAG-1 <NA> TRBV10-2.None.TRBJ2-1.TRBC2          <NA>
## 2 P17B_GGCTCGAGTCGCGGTT-1 <NA> TRBV10-3.None.TRBJ2-1.TRBC2   cluster.394
## 3 P17B_CGCGTTTTCGGCTACG-1 <NA> TRBV11-3.None.TRBJ1-2.TRBC1          <NA>
## 4 P17B_CACCAGGGTTCCTCCA-1 <NA> TRBV11-3.None.TRBJ2-3.TRBC2    cluster.23
## 5 P17B_TCTATTGCAGGTGCCT-1 <NA> TRBV11-3.None.TRBJ2-3.TRBC2    cluster.23
## 6 P17B_GCTGGGTGTACGAAAT-1 <NA> TRBV12-4.None.TRBJ1-2.TRBC1   cluster.262

11.1.8 Using Different Clustering Algorithms

While the default cluster.method = "components" is robust, you can use other algorithms from the igraph package, such as walktrap or louvain, to potentially uncover different community structures.

# Cluster using the walktrap algorithm
graph_walktrap <- clonalCluster(combined.TCR[c(1,2)],
                                cluster.method = "walktrap",
                                exportGraph = TRUE)

# Compare the number of clusters found
length(unique(V(graph_walktrap)$cluster))
## [1] 419

Overall, clonalCluster() is a versatile function for defining and analyzing clonal relationships based on sequence similarity. It allows researchers to move beyond exact sequence matches, providing a more comprehensive understanding of clonal families. The ability to customize parameters like threshold, chain selection, and group.by ensures adaptability to diverse research questions. Furthermore, the option to export igraph objects or sparse adjacency matrices provides advanced users with the tools for in-depth network analysis.


12 Conclusion

This has been a general overview of the capabilities of scRepertoire from the initial processing and visualization to attach to the mRNA expression values in a single-cell object. If you have any questions, comments, or suggestions, please visit the GitHub repository.

12.0.1 Session Info

sessionInfo()
## R version 4.6.0 Patched (2026-05-01 r89994)
## Platform: aarch64-apple-darwin23
## Running under: macOS Tahoe 26.3.1
## 
## Matrix products: default
## BLAS:   /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRblas.0.dylib 
## LAPACK: /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRlapack.dylib;  LAPACK version 3.12.1
## 
## locale:
## [1] C/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
## 
## time zone: America/New_York
## tzcode source: internal
## 
## attached base packages:
## [1] stats4    stats     graphics  grDevices utils     datasets  methods  
## [8] base     
## 
## other attached packages:
##  [1] scales_1.4.0                circlize_0.4.18            
##  [3] ggraph_2.2.2                scRepertoire_2.9.0         
##  [5] igraph_2.3.1                Seurat_5.5.0               
##  [7] SeuratObject_5.4.0          sp_2.2-1                   
##  [9] scater_1.41.1               ggplot2_4.0.3              
## [11] scuttle_1.23.1              SingleCellExperiment_1.35.1
## [13] SummarizedExperiment_1.43.0 Biobase_2.73.1             
## [15] GenomicRanges_1.65.0        Seqinfo_1.3.0              
## [17] IRanges_2.47.1              S4Vectors_0.51.2           
## [19] BiocGenerics_0.59.2         generics_0.1.4             
## [21] MatrixGenerics_1.25.0       matrixStats_1.5.0          
## [23] BiocStyle_2.41.0           
## 
## loaded via a namespace (and not attached):
##   [1] RcppAnnoy_0.0.23       splines_4.6.0          later_1.4.8           
##   [4] tibble_3.3.1           polyclip_1.10-7        fastDummies_1.7.6     
##   [7] lifecycle_1.0.5        globals_0.19.1         lattice_0.22-9        
##  [10] MASS_7.3-65            magrittr_2.0.5         plotly_4.12.0         
##  [13] sass_0.4.10            rmarkdown_2.31         jquerylib_0.1.4       
##  [16] yaml_2.3.12            httpuv_1.6.17          otel_0.2.0            
##  [19] sctransform_0.4.3      spam_2.11-3            spatstat.sparse_3.1-0 
##  [22] reticulate_1.46.0      cowplot_1.2.0          pbapply_1.7-4         
##  [25] RColorBrewer_1.1-3     abind_1.4-8            Rtsne_0.17            
##  [28] purrr_1.2.2            tweenr_2.0.3           evmix_2.12            
##  [31] ggrepel_0.9.8          irlba_2.3.7            listenv_0.10.1        
##  [34] spatstat.utils_3.2-3   iNEXT_3.0.2            MatrixModels_0.5-4    
##  [37] goftest_1.2-3          RSpectra_0.16-2        spatstat.random_3.4-5 
##  [40] fitdistrplus_1.2-6     parallelly_1.47.0      codetools_0.2-20      
##  [43] DelayedArray_0.39.2    ggforce_0.5.0          shape_1.4.6.1         
##  [46] tidyselect_1.2.1       farver_2.1.2           ScaledMatrix_1.21.0   
##  [49] viridis_0.6.5          spatstat.explore_3.8-0 jsonlite_2.0.0        
##  [52] BiocNeighbors_2.7.2    tidygraph_1.3.1        progressr_0.19.0      
##  [55] ggridges_0.5.7         ggalluvial_0.12.6      survival_3.8-6        
##  [58] tools_4.6.0            ica_1.0-3              Rcpp_1.1.1-1.1        
##  [61] glue_1.8.1             gridExtra_2.3          SparseArray_1.13.2    
##  [64] xfun_0.57              dplyr_1.2.1            withr_3.0.2           
##  [67] BiocManager_1.30.27    fastmap_1.2.0          SparseM_1.84-2        
##  [70] digest_0.6.39          rsvd_1.0.5             R6_2.6.1              
##  [73] mime_0.13              colorspace_2.1-2       scattermore_1.2       
##  [76] tensor_1.5.1           dichromat_2.0-0.1      spatstat.data_3.1-9   
##  [79] utf8_1.2.6             tidyr_1.3.2            data.table_1.18.4     
##  [82] graphlayouts_1.2.3     httr_1.4.8             htmlwidgets_1.6.4     
##  [85] S4Arrays_1.13.0        uwot_0.2.4             pkgconfig_2.0.3       
##  [88] gtable_0.3.6           lmtest_0.9-40          S7_0.2.2              
##  [91] XVector_0.53.0         htmltools_0.5.9        dotCall64_1.2         
##  [94] bookdown_0.46          png_0.1-9              spatstat.univar_3.2-0 
##  [97] ggdendro_0.2.0         knitr_1.51             rjson_0.2.23          
## [100] reshape2_1.4.5         nlme_3.1-169           GlobalOptions_0.1.4   
## [103] cachem_1.1.0           zoo_1.8-15             stringr_1.6.0         
## [106] KernSmooth_2.23-26     parallel_4.6.0         miniUI_0.1.2          
## [109] vipor_0.4.7            pillar_1.11.1          grid_4.6.0            
## [112] vctrs_0.7.3            RANN_2.6.2             promises_1.5.0        
## [115] BiocSingular_1.29.0    beachmat_2.29.0        xtable_1.8-8          
## [118] cluster_2.1.8.2        beeswarm_0.4.0         evaluate_1.0.5        
## [121] isoband_0.3.0          magick_2.9.1           tinytex_0.59          
## [124] cli_3.6.6              compiler_4.6.0         rlang_1.2.0           
## [127] future.apply_1.20.2    labeling_0.4.3         immApex_1.7.0         
## [130] plyr_1.8.9             ggbeeswarm_0.7.3       stringi_1.8.7         
## [133] viridisLite_0.4.3      deldir_2.0-4           BiocParallel_1.47.0   
## [136] gsl_2.1-9              lazyeval_0.2.3         spatstat.geom_3.7-3   
## [139] quantreg_6.1           Matrix_1.7-5           RcppHNSW_0.6.0        
## [142] patchwork_1.3.2        future_1.70.0          shiny_1.13.0          
## [145] ROCR_1.0-12            memoise_2.0.1          bslib_0.11.0