Provides basic instructions to create minimal visualizations of pairwise alignments from various inputs.
ggseqalign 1.6.0
Showing small differences between two long strings, such as DNA or AA
sequences is challenging, especially in R. Typically, DNA or AA sequence
alignments show all characters in a sequence. The package
ggmsa does this really well and is compatible with
ggplot2. However, this is not viable for sequences over a certain
length.
Alternatively, top level visualizations may, for example, represent
degree of variation over the length in a line plot, making it possible
to gauge how strongly sequences differ, but not the quality of the
difference. The intention with this package is to provide a way to
visualize sequence alignments over the whole length of arbitrarily long
sequences without losing the ability to show small differences, see
figure 1.
Figure 1: Example of ggseqalign visualization
Showcase of the package’s capability to highlight differences between 2000 bp long DNA sequences.
ggseqalign can be installed from Bioconductor.
if (!require("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("ggseqalign")
See the BiocManager vignette for instructions on using multiple versions of Bioconductor.
ggseqalign can also be installed from it’s original source on GitHub
(requires devtools)
devtools::install_git("https://github.com/simeross/ggseqalign.git")
This package relies on two core functions, alignment_table() and
plot_sequence_alignment(). At its core, the former uses
PairwiseAlignment(), previously in Biostrings, now in
pwalign, to align one or several query strings to a
subject string to parse all information on mismatches, insertions and
deletions into a table that is used as the input for plotting with
plot_sequence_alignment().
A minimal example:
library(ggseqalign)
library(ggplot2)
query_strings <- (c("boo", "fibububuzz", "bozz", "baofuzz"))
subject_string <- "boofizz"
alignment <- alignment_table(query_strings, subject_string)
plot_sequence_alignment(alignment) +
theme(text = element_text(size = 15))
Figure 2: Output of the minimal example code
This package is fully compatible with DNAStringSetand AAStringSet
classes from Biostrings, an efficient and powerful way to
handle sequence data. The two examples below use
example data from the Biostrings package and requires it
to be installed. To install Biostrings, enter
if (!require("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("Biostrings")
This chunk demonstrates reading sequence data from
a FASTA file into a DNAStringSet-class object and aligning it to a
manually created DNAStringSet-class object.
library(ggseqalign)
library(Biostrings)
library(ggplot2)
query_sequences <- Biostrings::readDNAStringSet(system.file("extdata",
"fastaEx.fa",
package = "Biostrings"
))
subject_sequence <- DNAStringSet(paste0("AAACGATCGATCGTAGTCGACTGATGT",
"AGTATATACGTCGTACGTAGCATCGTC",
"AGTTACTGCATGCCGG"))
alignment <- alignment_table(query_sequences, subject_sequence)
plot_sequence_alignment(alignment) +
theme(text = element_text(size = 15))
The plots that plot_sequence_alignment() generates can become hard to
read if there are too many differences, see fig. 3.
The package allows to hide character mismatches to preserve legibility
of structural differences (fig. 4).
# load
dna <- Biostrings::readDNAStringSet(system.file("extdata",
"dm3_upstream2000.fa.gz",
package = "Biostrings"
))
q <- as(
c(substr(dna[[1]], 100, 300)),
"DNAStringSet"
)
s <- as(
c(substr(dna[[2]], 100, 300)),
"DNAStringSet"
)
names(q) <- c("noisy alignment")
names(s) <- "reference"
plot_sequence_alignment(alignment_table(q, s)) +
theme(text = element_text(size = 15))
Figure 3: Example of a case where ggseqalign fails
If there are too many differences, the mismatches overlap each other and become noisy.
plot_sequence_alignment(alignment_table(q, s), hide_mismatches = TRUE) +
theme(text = element_text(size = 15))
Figure 4: Hiding mismatches
Hiding character mismatches reduces visual noise if alignments have many character mismatches and preserves structural information.
Since plot_sequence_alignment() produces a ggplot-class object, all
aspects of the plots can be modified with ggplot2
functions, such as theme(). As an example, let’s recreate and modify
figure 1.
library(ggseqalign)
library(ggplot2)
library(Biostrings)
dna <- readDNAStringSet(system.file("extdata", "dm3_upstream2000.fa.gz",
package = "Biostrings"
))
q <- dna[2:4]
s <- dna[5]
q[1] <- as(
replaceLetterAt(q[[1]], c(5, 200, 400), "AGC"),
"DNAStringSet"
)
q[2] <- as(
c(substr(q[[2]], 300, 1500), substr(q[[2]], 1800, 2000)),
"DNAStringSet"
)
q[3] <- as(
replaceAt(
q[[3]], 1500,
paste(rep("A", 1000), collapse = "")
),
"DNAStringSet"
)
names(q) <- c("mismatches", "deletions", "insertion")
names(s) <- "reference"
pl <- plot_sequence_alignment(alignment_table(q, s))
pl <- pl +
ylab("Sequence variants") +
xlab("Length in bp") +
scale_color_viridis_d() +
theme(
text = element_text(size = 20),
axis.text.x = element_text(angle = 90, vjust = 0.5, hjust = 1),
axis.title = element_text()
)
pl
Figure 5: Styling with ggplot2
In this example, text size was increased, axis labels were added, x-axis text rotated and the color scheme changed.
Some modifications may require digging into the plot object layers, this
can get finicky but is possible. We can use pl$layers to get a summary
of the object’s layers. In this case, the geom_point layers that plot
the dots for mismatches are entry 8 in the layer list, the white bar
that indicates deletions is usually in layer 2. You may want to change
the deletion bar’s color if you use another plot background color. This
code chunk modifies the pl object from the previous chunk; the above
chunk has to be run prior to this one.
# Define background color
bg <- "grey90"
# Change plot background
pl <- pl + theme(panel.background = element_rect(
fill = bg,
colour = bg
))
# Match deletion to background
pl$layers[[2]]$aes_params$colour <- bg
# Increase mismatch indicator size and change shape
pl$layers[[8]]$aes_params$size <- 2
pl$layers[[8]]$aes_params$shape <- 4
pl$layers[[8]]$aes_params$colour <- "black"
pl
Figure 6: Modifying ggplot2 layers
In this example, deletion bars were adjusted to match background color and mismatch indicators were modified using plot layer modification
Any additional parameters to alignment_table() are passed on to
pwalign::pairwiseAlignment(), check
pwalign for a
comprehensive overview over the available options. As a simple example,
we may increase gap penalties for the alignment in
2.
library(ggseqalign)
library(ggplot2)
query_strings <- (c("boo", "fibububuzz", "bozz", "baofuzz"))
subject_string <- "boofizz"
alignment <- alignment_table(query_strings, subject_string, gapOpening = 20)
plot_sequence_alignment(alignment) +
theme(text = element_text(size = 15))
Figure 7: Modified alignment parameters
The output in this vignette was produced under the following conditions:
sessionInfo()
## R version 4.6.0 RC (2026-04-17 r89917)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /home/biocbuild/bbs-3.23-bioc/R/lib/libRblas.so
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.12.0 LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_GB LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: America/New_York
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] ggplot2_4.0.3 ggseqalign_1.6.0 Biostrings_2.80.0
## [4] Seqinfo_1.2.0 XVector_0.52.0 IRanges_2.46.0
## [7] S4Vectors_0.50.0 BiocGenerics_0.58.0 generics_0.1.4
## [10] BiocStyle_2.40.0
##
## loaded via a namespace (and not attached):
## [1] gtable_0.3.6 jsonlite_2.0.0 dplyr_1.2.1
## [4] compiler_4.6.0 BiocManager_1.30.27 crayon_1.5.3
## [7] Rcpp_1.1.1-1.1 tinytex_0.59 tidyselect_1.2.1
## [10] magick_2.9.1 dichromat_2.0-0.1 jquerylib_0.1.4
## [13] scales_1.4.0 yaml_2.3.12 fastmap_1.2.0
## [16] R6_2.6.1 labeling_0.4.3 knitr_1.51
## [19] tibble_3.3.1 bookdown_0.46 RColorBrewer_1.1-3
## [22] bslib_0.10.0 pillar_1.11.1 rlang_1.2.0
## [25] cachem_1.1.0 pwalign_1.8.0 xfun_0.57
## [28] S7_0.2.2 sass_0.4.10 otel_0.2.0
## [31] viridisLite_0.4.3 cli_3.6.6 withr_3.0.2
## [34] magrittr_2.0.5 digest_0.6.39 grid_4.6.0
## [37] lifecycle_1.0.5 vctrs_0.7.3 evaluate_1.0.5
## [40] glue_1.8.1 farver_2.1.2 rmarkdown_2.31
## [43] tools_4.6.0 pkgconfig_2.0.3 htmltools_0.5.9
The research and data generation that was a major motivation for me to finally create this package has received funding from the Norwegian Financial Mechanism 2014-2021, project DivGene: UMO-2019/34/H/NZ9/00559