| GC2 {seqinr} | R Documentation |
This calculates the fraction of G+C in the second position of the codon bases of the input nucleic acid sequence(s)
GC2(seq)
seq |
any nucleic acid sequence |
It returns the fraction of GC2 as a numeric vector
D. Charif
To have an overview of the seqinR's functionnality, please consult this vignette:
Charif, D., Lobry, J.R. (2005) SeqinR: a contributed package to the R project for statistical
computing devoted to biological sequences retrieval and analysis. Springer Verlag, Biological and Medical Physics/Biomedical Series, in preparation.
s=s2c("agtctggggggccccttttaagtagatagatagctagtcgta")
GC2(s)